
Concept explainers
Introduction:
The term observation means to analyze the knowledge of the outside world by seeing it or recording information from scientific experiments. Moreover, in a lab the data recorded or received is termed as the observation.

Answer to Problem 1STP
Correct option:
Option (C), butterflies eat nectar from flowers.
Explanation of Solution
Explanation/justification for the correct answer:
Option (C) is butterflies eat nectar from flowers. When butterflies eat nectar from the flowers, then it is easily observed by the human eyes. Both the butterflies and the flowers are macroscopic living beings. So, it is a kind of direct observation, where scientists need not perform any experiment. Hence, this option is correct.
Explanation for incorrect answer:
Option (A) is ants communicate by airborne chemicals. To analyze how ants communicate can only be observed by certain experiments. The communication between ants cannot be directly observed. Hence, this option is incorrect.
Option (B) is birds navigate by using magnetic fields. The magnetic field in birds can only be determined by studying the anatomy of birds or by setting up an experiment. This cannot be directly observed. Hence, this option is incorrect.
Option (D) is fish feel vibrations through special sensors. If fish feels vibrations through special sensors or not is observed by keeping it near sensors. For this, experiments needs to be set up and readings should be noted. It cannot be observed directly. Hence, this option is incorrect.
Option (C), butterflies eat nectar from flowers is the correct answer.
Chapter 1 Solutions
Biology Illinois Edition (Glencoe Science)
Additional Science Textbook Solutions
Biological Science (6th Edition)
College Physics: A Strategic Approach (3rd Edition)
Chemistry: An Introduction to General, Organic, and Biological Chemistry (13th Edition)
Campbell Biology (11th Edition)
Organic Chemistry (8th Edition)
Introductory Chemistry (6th Edition)
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





