
Introduction:
Living organisms vary from the single celled prokaryotic cells to the multicellular eukaryotic cells. Life or living organisms perform the basic functions of life that is respiration, locomotion, obtaining nutrition, response to stimulus, reproduction, growth and excretion. These functions distinguish them from non living entities.

Explanation of Solution
Correct answer:
The entire living organisms do not care for their offspring. Therefore, option (c) is correct.
Explanation for the correct answer:
The organisms, such as mammals, fishes, and birds care for their offspring until they get mature and are able to survive in nature. Some of the organisms do not care for their offspring. Instead, they leave them after the offspring’s are formed.
Option (c) is given as “care for their offspring”.
As, “all of the offspring are not cared by their living organisms”, is the right answer.
Hence, option (c) is correct.
Explanations for incorrect answers:
Option (a) is given as “organization”. The living organisms have a certain level of organization of
Option (b) is given as “acquisition of materials and energy”. The living organisms consume food and generate energy from their cellular activities. So, it is a wrong answer.
Option (d) is given as “reproduction”. All the living organisms reproduce and produce their offspring. Reproduction is an important key to the survival of organisms.
So, it is a wrong answer.
Option (e) is given as “responding to the environment”. All the living organisms respond to the external stimulus. So, it is a wrong answer.
Hence, options (a), (b), (d), and (e) are incorrect.
All the progeny are not are not taken care by their parental living organisms.
Want to see more full solutions like this?
Chapter 1 Solutions
Lab Manual for Biology
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





