Write down all possible outcomes for template ATGCCTAAGTTTCCCTAT sequencing

Q: Explain why exome sequencing can be almost as valuable as genome sequencing.

A: Whole genome sequencing refers to technique which used to analyze complete genome of an organism at…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'-…

A: This method is used for DNA sequencing and it relies on the use of Deoxyribonucleoside…

Q: Describe the 2 main types of sequencing prior to next generation sequencing.

A: DNA sequencing:As the name suggests "DNA sequencing" is a method that can help us determine the…

Q: Describe the automated dideoxy chain termination method of DNA sequencing.

A: The chain termination DNA sequencing method is the Sangers sequencing in which the DNA fragment is…

Q: List three independent techniques you could use toidentify DNA sequences encoding human geneswithin…

A: A genome is referred to as genetic material of the organism that composed of DNA or RNA. The genome…

Q: Describe step 1: hybridization of template and primer in automated sanger sequencing

A: Introduction  Sanger sequencing is also known as the “chain termination method”. It is a method for…

Q: Describe the process of cloning a DNA fragment into the BamHI and PstI sites of the vector pUC18.…

A: A cloning vector is a DNA molecule used as a vehicle to artificially carry foreign genetic material…

Q: process of overlap assembly in whole genome sequencing

A: Genome sequencing Genome sequencing or gene sequencing is a way of arranging nucleotides the n the…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Discuss the process and principle involved for screening/selection of hosts (last stage of cloning)…

A: Molecular cloning or cloning is a technique to assemble DNA of two different organisms and directing…

Q: The following DNA sequences were used to generate a contig from a genome sequencing project.…

A: Sequencing It is a method through which the complete genetic makeup of the organism is identified.…

Q: Shown below are several next-generation sequencing reads from a sample you have. Which of the…

A: Genomic research has been revolutionised by next-generation sequencing (NGS), commonly referred to…

Q: Which RE can be used to distinguish bacterial strain 1 from strain 2 based on a sample DNA fragment…

A: Restriction enzymes are a type of nuclease that cuts DNA at a specific sequence of nucleotides. They…

Q: Ehat  primer sets could be amplify the following DNA sequence?   AATACGTCGCATGGggatccttttttatgcatg

A: Amplification of DNA sequence is done by the polymerase chain reaction. With the help of DNA…

Q: Describe the differences between the hierarchical andshotgun strategies for genome sequencing.

A: There are two approaches exist in sequencing of huge genomes. These are as follows: The…

Q: An optimum ligation reaction should contain approximately 50 ng of vector. Given your concentrations…

A: It is given that an optimum ligation reaction should contain approximately 50 ng of the vector. We…

Q: Briefly describe what happens during each of the phases of PCR (denaturation, annealing, and…

A: The “polymerase chain reaction” (PCR) is a technique in which millions of copies of the target DNA…

Q: Describe the features of a typical CRISPR locus in a bacterial cell.

A: CRISPR (short for clustered regularly interspaced short palindromic repeat) acts as the immune…

Q: Write and briefly define the steps sequentially to clone the gene from the genomic DNA o

A: DNA recombinant molecules from two different types are inserted into living things to produce new…

Q: Traditional Sanger sequencing has largely been replaced in recent years by next-generation and…

A: BASIC INFORMATION  Gene Sequencing  It is a process through which the arrangement of of the…

Q: Transcribe and translate the following template sequence: CACGTAAAG.

A: The nucleotides in the template sequence "CACGTAAAG" are arranged in a certain way and are denoted…

Q: Describe how Sanger sequencing works. Make sure to mention dNTPs, ddNTPS, template strand, primers:

A: It is also known as "Chain termination method" or "dideoxy method", used for determining the…

Q: Describe how Ion torren method of sequencing works in detail.

A: Thermo Fisher Scientific's Ion Torrent technology brings a whole new method to Next Generation…

Q: describe the Illumina/Solexa method of "massively parallel DNA sequencing"

A: The Illumina/Solexa method is a technique used for massively parallel DNA sequencing. This method is…

Q: Describe the role of complementary base pairing duringRT-PCR, DNA microarray analysis, RNA…

A: Complementary base pairing is the process in which purine binds to pyrimidines with the help of…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.