Please read part 2 carefully. Python code. SEE IMAGESSimple please. Assume a **Dictionary** structure has been defined that associates letter grades to their respective integer "quality point" values used for calculating a student's grade point average. The name of the structure is **gradePoints**. Write a statement to retrieve the quality point value for a letter grade of "C". Store the retrieved value in a variable named **"qPoints"**. ### Python Function RequirementsTo fulfill the task, create a Python function building on the following criteria:- **Function Name**: `findPoints`- **Parameters**: Accepts a single argument of type `string`.- **Functionality**: Utilizes the given argument to fetch the corresponding integer point value from a `dictionary` named `gradePoints`. The `gradePoints` dictionary is previously referenced in another question (Question 07).- **Output**: Returns the fetched integer value.This task involves retrieving data using a key from a dictionary structure, a common operation in Python programming to help manage and manipulate data efficiently.

Create a dictionary structure with the quality points associates with the grade letter. The name of…

Write a Python function that meets the following requirements: • Is named findPoints • Accept a single argument of type string • Use the argument to retrieve the related integer point value from the Dictionary named gradePoints referenced in Question 07 • Returns the retrieved integer value

Write a Python function that meets the following requirements: • Is named findPoints • Accept a single argument of type string • Use the argument to retrieve the related integer point value from the Dictionary named gradePoints referenced in Question 07 • Returns the retrieved integer value

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: More data is usually better in computer programming, but speed shouldn't be the only factor.

A: Deep/shallow binding makes perfect sense in situations in which a procedure may be sent in as an…

Q: Difficult Python: How do I create a plot y = x^2 and then allow the user to click on its…

A: 1. Import necessary libraries.2. Define on_click(event) function: - Initialize points list. - On…

Q: Video Graphics Array (VGA) mode is used to show images on a screen. Where do you get your…

A: Introduction: VGA mode is used to show output on a monitor. The most common way to connect an…

Q: I've been given this problem and I need to use a loop to create these patterns. I remember using a…

A: Use of for loop: We use for loop when we know how many times the loop will going to execute. Use of…

Q: Python programming only (PLEASE INCLUDE INPUT VALIDATION IF NEEDED) a province gathers local…

A: Start.Create a function calculate_property_tax that takes the actual property value as…

Q: OpenGL Programming Help (please provide a screenshot that it works) Write a program that creates a…

A: The provided code is a simple OpenGL program written in C language that displays two letter "I"s on…

Q: First, compare the areas of the two polygons. Print out which polygon's area is greater (or if they…

A: float(input()) is used to convert input to float math.sqrt is used to find square root elif is used…

Q: Explain why a designer would opt for spiral development as opposed to a top-down approach. Python

A: Spiral development is a software development methodology that involves a cyclical approach to the…

Q: How many arguments do you pass when you call the TryGetValue method? Briefly discuss these arguments

A: If your code regularly tries to access keys that are not in the dictionary, use the TryGetValue…

Q: PLEASE CODE IN PYTHON Problem Description Boring is a type of drilling, specifically, the drilling…

A: Given: PLEASE CODE IN PYTHON Problem DescriptionBoring is a type of drilling, specifically, the…

Q: describe what factors might lead a designer to choose spiral development over a top-down approach.…

A: Spiral development is a flexible development. we can make changes at any level with ease. In spiral…

Q: Strings) Exercise-Displaying Values Exercise: Displaying Values You may recall from an earlier…

A: Since no programming language is mentioned, I am using python. Algorithm: Start Initialize…

Q: Hustle up the Hancock. Every February the Respiratory Health Association of Chicago hosts the…

A: A function hustle(n) is made which takes a single parameter n as number of steps. A list is made for…

Q: Computer Graphics: Using Unreal Engine or any CGI Software provide two rendered objects in which…

A: The question has been answered in step2

Q: In this section, you will provide a summary of the compiler and talk about how testable it is.

A: INTRODUCTION: A computer application called a compiler assists you in turning high-level source code…

Q: . Pseudocode

Q: Does the code editor crash if you keep the mouse pointer on a wavy line for an extended period of…

A: The Answer is in given below steps

Q: Write a program to draw a chessboard, as shown in Figure 5.6b.

A: Phyton language program has a inbuilt module which gives the board and pen to draw on the…

Q: 1. Create an array containing 100 random numbers in the range of 1 and 2.

A: For creating the array of 100 random numbers in the range of 1 and 2, do the following: Import…

Q: Use the turtle graphics library to write programs that reproduce each of the designs shown in Figure…

A: from turtle import * #Define the function def drawing1(): p = Pen()…

Q: please use c# i just want you to modify the code please Download the solution and run it…

A: Programming Approach : The program defines a class called "Employee", which represents an…

Q: Help with Python Turtle: Need help finalizing turtle drawing and to be fixed. I've included an…

A: In the revised code, several significant changes were made to ensure the final turtle drawing meets…

Question

Please read part 2 carefully. Python code. SEE IMAGES

Simple please.

Assume a **Dictionary** structure has been defined that associates letter grades to their respective integer "quality point" values used for calculating a student's grade point average. The name of the structure is **gradePoints**. Write a statement to retrieve the quality point value for a letter grade of "C". Store the retrieved value in a variable named **"qPoints"**.

### Python Function Requirements

To fulfill the task, create a Python function building on the following criteria:

- **Function Name**: `findPoints`
- **Parameters**: Accepts a single argument of type `string`.
- **Functionality**: Utilizes the given argument to fetch the corresponding integer point value from a `dictionary` named `gradePoints`. The `gradePoints` dictionary is previously referenced in another question (Question 07).
- **Output**: Returns the fetched integer value.

This task involves retrieving data using a key from a dictionary structure, a common operation in Python programming to help manage and manipulate data efficiently.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

need help for Python
4
Explain "motion input." Give instances of motion input's various applications in medical, military, sports, and entertainment.
Coding in python Please!!I need help please help me in the easiest way to do this coding question. Please do not post it's answer from chegg just use your own skills to write code in easyiest way possible. I will really appriciate your help. Coding language PYTHON : The purpose of this assignment is to help you get comfortable creating and using simple classes and objects. In this assignment, we wish to model a 2-D video game character’s movements. In particular, suppose we are creating a tiny game, where the character can occupy one of 25 squares, like so: The first thing we need to keep track of is the character’s name, so we can differentiate this character from other characters or enemies. The other thing we need to keep track of is the character’s position, i.e., which square they are in. In order to do this, we’ll use an X-Y coordinate system with the origin in the top left corner (the 0,0 square in the picture). So, in the picture, the character occupies square 3, 2;…
OpenGL Programming Help (please provide a screenshot that it works) Write a program that creates a three-dimensional figure of the University logo "IU" that animates. The In response to the menu selection, one of the two letters will spin about a vertical axis. When the user clicks on the right mouse button and selects the menu option to spin the “U”, the “I” should stop spinning and the “U” should spin in the same manner. At no point should both letters spin at the same time. This should use a display list
Python(turtle) Use turtle graphics to draw a house! A house, should have: walls roof door 2-4 windows Sample house below Pseudo Code Function draw_window(x, y): (x, y passing location) Draw window without inner grid Draw inner grid of window Main Draw top and right side wall of house Draw bottom and door of house Draw left wall and roof Draw_window(x, y) – first location Draw_window(x, y) – second location Draw_window(x, y) – third location Provide the REPL weblink in the URL entry and submit the assignment.
Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…
To facilitate comprehension of the code, we use a variety of design techniques.
Python 3
OpenGL Programming Help (please provide a screenshot that it works) Write a program that creates a three-dimensional captial "U" that animates. In response to the menu selection, 1.spin the "U" vertically 2. stop spinning When the user clicks on the right mouse button and selects the menu option to spin the "U" it should spin in the letter.
Write a program that accepts two four-digit binary numbers, converts them to decimal values, adds them together, and prints both the decimal values and the result of the addition. Requirements: Functionality. (80pts) No Syntax Errors. (80pts*) *Code that cannot be compiled due to syntax errors is nonfunctional code and will receive no points for this entire section. Clear and Easy-To-Use Interface. (10pts) Users should easily understand what the program does and how to use it. Users should be prompted for input and should be able to enter data easily. Users should be presented with output after major functions, operations, or calculations. All the above must apply for full credit. Users must be able to enter a 4-bit binary number in some way. (10pts) No error checking is needed here and you may assume that users will only enter 0’s and 1’s, and they will only enter 4 bits. Binary to Decimal Conversion (50pts) You may assume that users will only give numbers that add up to…
Describe the factors that may influence a designer's decision to employ spiral development as opposed to a top-down approach. Python