Write a program that uses stacks to evaluate an arithmetic expression in infix notation without converting it into postfix notation. The program takes as input a numeric expression in infix notation, such as 3+4*2, and outputs the result. 1) Operators are +, -, *,/ 2) Assume that the expression is formed correctly so that each operation has two arguments. 3) The expression can have parenthesis, for example: 3*(4-2)+6. 4) The expression can have negative numbers. 5) The expression can have spaces in it, for example: 3 * (4-2) +6. Here are some useful functions that you may need: char cin.peck(); -- returns the next character of the cin input stream ( without reading it) bool isdigit(char c); -- returns true if c is one of the digits 'o* through '9", false otherwise cin.ignore(); -- reads and discards the next character from the cin input stream cin.get(char &c); -- reads a character in c ( could be a space or the new line )

Write a program that uses stacks to evaluate an arithmetic expression in infix notation without converting it into postfix notation. The program takes as input a numeric expression in infix notation, such as 3+42, and outputs the result. 1) Operators are +, -, ,/ 2) Assume that the expression is formed correctly so that each operation has two arguments. 3) The expression can have parenthesis, for example: 3(4-2)+6. 4) The expression can have negative numbers. 5) The expression can have spaces in it, for example: 3 (4-2) +6. Here are some useful functions that you may need: char cin.peck(); -- returns the next character of the cin input stream ( without reading it) bool isdigit(char c); -- returns true if c is one of the digits 'o* through '9", false otherwise cin.ignore(); -- reads and discards the next character from the cin input stream cin.get(char &c); -- reads a character in c ( could be a space or the new line )

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

I need the answer as soon as possible
C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: N
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
#include // Function to calculate the factorial of a given positive integer int factorial(int n) { // TODO: Implement the factorial function here } int main() { int num; printf("Enter a positive integer: "); scanf("%d", &num); // TODO: Call the factorial function and print the result } return 0; • Q1: Write a C program to calculate the factorial of a given positive integer entered by the user.
C++ LANGUAGE (FUNCTION)
C++ Nothing too advanced please. Learning the basics #include <iostream>using namespace std;int main()
Fundamentals of Programming in C Language Write the value of each of the following expressions, using the following data declarations: double m = 17.5; int y = 9; 1. (m > 12.0) && (y / 2 <= 4) 2. (y % 3 != 0) 3. (m < 2 * y) 4. (2 == 3) || (m - 16 >= 0)
JAVA CODE PLEASE Recursive Functions Practice ll by CodeChum Admin Create a recursive function named factorial that accepts an integer input as a parameter. This calculates the factorial of that integer through recursion and return it. In the main function, call the factorial function and assign the value to a variable. Print the value in the next line. Input 1. One line containing an integer Output Enter·a·number:·4 24
C programming
Programming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replace