Will reveal RFLP polymorphism between the DNA samples after probe detection/visualization; and

Using the “target DNA” sequence provided in the attached image, what sizes of inserts can be prepared using HindIII digestion? Which one contains the coding sequence?

he gel presented here shows the pattern of bands of fragments produced with several restriction enzymes.  (a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?

A cloned Bam HI DNA fragment, 3.0 kb long, was isolated in preparation for sequence determination. First, a map of restriction endonuclease cleavage sites had to be prepared. Cleavage by each of the indicated enzymes generated fragments of the sizes shown on the three agarose electrophoresis gel figures below; the gels are running from top to bottom. On the diagram below those, show the relative positions of EcoR I and Hpa II cleavage sites and the distances (in kb) between them. Explain your reasoning – is your placement of the cleavage sites the only one that will work?

The recognition sequence for the restriction enzyme TaqI is T↓CGA. Indicate the products of the reaction of TaqI with the DNA sequence shown.

Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the pMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol *The same total amount of DNA was loaded in each lane. 1. What is the total size of the pMBBS plasmid in bp? Answer: bp + DNA size ladder 2. How many cut sites on the PMBBS plasmid does each RE have? EcoRI: BamHI: Xhol: 3000 bp 2500 bp -2000 bp -1500 bp 1200 bp 1000 bp 900 bp 800 bp 700 bp 600 bp 500 bp 400 bp 300 bp 200 bp…

Please in detail, what the picture attached represents

1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200

HgaI recognizes a specific 5 bp sequence. How frequently would you expect a specific 5 bp sequence to be found in any genome, considering that there are 4 possibilities for each of the 5 nucleotides in the restriction site sequence?

After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…