Why genes persist in organelle genomes

Q: Why DNA repair systems is important ?

A: DNA is the genetic material that carries information from parents to offsprings. DNA in a cell can…

Q: What is the relationship between cells, the nucleus, chromosomes, genes, and DNA? Explain and draw a…

A: All the eukaryotic cells have nucleus. Chromosomes, which are found in the cell nucleus, carry…

Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…

A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…

Q: One difference between eukaryotic and prokaryotic cells is that eukaryotic cells ______ prokaryotic…

A: Eukaryotic cells are complex cells found in plants, animals, fungi, and protists. They are…

Q: This organelle is now thought to have been a prokaryote that gave up genes in order to live inside a…

A: Endosymbiotic theory is a theory that explains us how the eukaryotic cells are originated from the…

Q: how can the chromosome packaging inside the nucleolus

A: Histones generally define that they are been helped the chromosomal DNA to be packed inside tiny…

Q: Sequence the flow of genetic information in the cell

A: A cell is the basic unit of life. Most cells are complete in themselves such that they carry all the…

Q: The part of a eukaryotic cell that produces secondary, tertiary, and quantenary proteins are ______.

A: Introduction: Ribosomes are complex molecular machines that are found in all living cells, including…

Q: Do cells make accurate copies of DNA? Explain with the help of a diagram

A: DNA replication is the process by which a cell makes an identical copy of its DNA. It is a…

Q: when the process of mitosis is used for organisms reproduction, are the new organisms exact genetic…

A: Cell cycle are the events that are required to divide the daughter cell from parent cell.

Q: When protoplasts and spheroplasts are made, the shape of the cell becomes spherical regardless of…

A: Protoplast is cell without cell wall. The cells here are either Plant cell or fungi or Gram positive…

Q: Define gene, cistron, exons, introns, and UTR.

A: Hereditary can be defined as the transfer of the characters from one generation to another. The…

Q: Is the DNA chromosomes replication of prokaryotic cells: bidirectional, semi-conservative, and…

A: A single, double stranded, long, helical structure that contains supercoiled DNA is known as a…

Q: A patient who has been diagnosed with cancer has been given a blood test in order for their doctors…

A: Cancer is the umbrella term for a group of diseases. Any of the body's cells tend to divide without…

Q: Define genetic information

A: Genetic material can be described in the form of DNA and RNA. DNA can be defined as the hereditary…

Q: Match each eukaryotic organelle with its corresponding function. [Each choice will be used exactly…

A: The objective of the question is to match each eukaryotic organelle with its corresponding function.

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.