Why can’t the lagging strand be synthesized in the same direction of the replication fork

What mechanism was originally proposed as one of the three models for DNA replication? What is the name given to the short stretches of DNA formed on the lagging strand? How can these short fragments be initiated?

The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side

Why is DNA replication is considered a semi-discontinuous process? Explain in detail.

Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two  Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?

What does DNA polymerase need in order to make contact with a replication origin?

If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)

DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional  mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options:   More point mutations will arise in MER-minus yeast.   Fewer point mutations will arise in MER-minus yeast as compared with wildtype.   Of the total point mutations that…

What is semiconservative replication and how does it work?

for the lagging strand, is it the upper or the lower?