Why are proteins important? * O They mostly make up our muscles They mostly make up our bones They mostly make up our brain matter They make up most of our physical traits and also help carry out processes within the body. They are our traits.

Q: The amino acids in a protein molecule are attached to each other by peptide bonds which are formed…

A: The amino amino acids in a protein molecule are attached to each other by peptide bonds which are…

Q: H3N. Amino acids are bonded together in a linear polymer to form peptides or proteins. A small…

A: Amino acids are biomolecules that have an amino group and a carboxyl group linked to the same carbon…

Q: © Macmillan Learning Classify each amino acid as polar neutral, hydrophobic, positively charged, or…

A: To classify each amino acid based on the categories provided:Polar Neutral:Thr (Threonine): The…

Q: Which amino acid(s) has the possibility of forming inter/intra polypeptide chain covalent bonds. O…

A: Amino acids are monomeric units of proteins and each protein is made up of more than hundreds of…

Q: Glucose is to a polysaccharide as... * O shoes are to feet O fruits are to vegetables O numbers are…

A: Most biomolecules are polymers made from different monomers. The common biomolecules include…

Q: Porin proteins allow the passage of molecules that are equal or greater than 600 Dalton in size.…

A: Gram-negative bacteria are found in nature and have a thin peptidoglycan layer along with an outer…

Q: Which characteristic is truc of protcins? O Proteins have up to four levels of structure. O Proteins…

A: Proteins are organic compounds which consists of amino acids, which are essential for carrying out…

Q: How to calculate the molecular weight of the given protein sequence;…

A: The given peptide is composed of glutamine, alanine, cysteine, glutamine, glutamine and isoleucine.…

Q: The human eye is a remarkable organ. It forms a high-resolution image by focusing light through a…

A: Eye is a paired sense and vital organ of human body. Eye reacts to light and allows vision in body.…

Q: BRET is a way to study protein-protein interactions. Describe BRET, and come up with one additional…

A: Protein-protein interaction (PPI) is the term used to describe the actual joining of two or more…

Q: What causes your DNA to change?

A: the DNA is a highly protected molecule that is not allowed to change because it may cause…

Q: Dietary fibers are refers to which kind of macromolecules

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: Compare protein 2 to protein 1. Does the amino acid sequence of protein 2 differ from the sequence…

A: Transcription and translation, these two processes are involved in protein synthesis. Transcription…

Q: What life experiences can someone havethat might coil or uncoil your DNA?

A: Epigenetics is an study of effects that environment and behavior have on genes.

Q: We know DNA as the blueprint of life and the important role it plays in cells. DNA is also in all of…

A: The four most important biomolecules in living things are carbohydrates, amino acids, nucleic acids,…

Q: What makes the protein folding process mysterious? X: There appears to be no intermediate states of…

A: What makes protein folding process mysterious?

Q: HO CH3 CH3 Gly Ser Gly Ala Gly Ala ZI IZ

A: The protein is formed when different amino acids are joined together by peptide bond. The peptide…

Q: DNA a protein?   What are the functions of protein? What exactly is a protein?…

A: Hey, since there are more multiple questions posted, we will answer first two questions for you. If…

Q: Can you please make a concept map containing about proteins

A:

Q: Motifs are usually produced by packing side chains from adjacent secondary structural elements close…

A: In the living system, amino acids play a significant role in most of the physiological actions like…

Q: How many peptide bonds are contained within the peptide structure depicted? goon ÇOOH COOH NH H2N'…

A: Protein is a nitrogenous organic macromolecule that is necessary for human health. It is responsible…

Q: Conjugated proteins which are a combination of amino acids and carbohydrates O A. nucleoproteins OB.…

A: Based on the composition, proteins are of two types, simple and conjugated proteins. The simple…

Q: How can we visualize DNA and RNA?

A: The nucleic acids are the biomolecules that consist of the genetic details of an individual. The…

Q: The amino acid that accounts for disulfide bonds in the tertiarystructure of proteins isa.…

A: The tertiary structure of the protein is the 3D structure of the protein in which one or more…

Q: The function of proteins is limited to one or two tasks. Proteins play multiple roles in living…

A: Signalling protein - involved on cellular communication  Structural protein - proteim that…

Q: transport substances through the blood

A: Question : Which is not a function of a protein.   Answer: Transport substances through the blood.…

Q: Hair: DNA: CCGGTGTACACAGGGACCATTCGATTA MRNA: protein: phenotype:

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: How is information to make proteins passed on through generations?

A: DNA is the genetic element of all the living organisms. They contain the genetic heredity…

Q: With some spare time on the weekend, you decide to see if what your biology instructor told you is…

A: Biological macromolecules are the substances that are needed in enough amount for body.  There are…

Q: Which three foods (from the table above) could each be eaten with rice as a complementary protein?

A: We are asked to come up with 3 complementary protein diets and the condition is that one of the food…

Q: bioinformatics help scientists understand the diversity of proteins?

A: Solution : Bioinformatics uses computer programs for a variety of applications, including…

Q: What does a peptide bond join?

A: A peptide is a Greek word which means "digested". A peptide is an amino acid chain that is short in…

Q: All life on Earth is based on carbon chemistry and the same twenty amino-acids. What do those…

A:

Q: You are studying Protein A. In the picture below, which location is Protein A MOST likely to move…

A: Membrane proteins are defined as proteins associated or attached to the membrane of a cell or an…

Q: Can someone dumb down emergent properties for me? I feel like the answer is simple but I dont quite…

A: Living things have different levels of organization. Smaller parts combine to make increasingly…

Q: f an amino acid sequence is altered, could that affect a protein's tertiary structure? Why or why…

A: The tertiary structure of the protein is the three-dimensional structure of the protein. The amino…

Q: The secondary structure of a protein is determined by the association with other proteins. O…

A: Biomolecules are organic compounds found in living organisms. All living organism will have these…

Q: 4. Which of the following is the CORRECT pair of a protein and its function? * A. Hemoglobin: helps…

A: Proteins are biomolecules composed of amino acid units. Proteins are the building blocks of the…

Q: Which of the following is NOT evidence for homology? (MARK ALL THAT APPLY) proteins that have some…

A:

Q: How we can get a better protein with better stability using protein engineering?

A: Protein stability is the protein's ability to sustain activity for an extended period of time at…

Q: Please explain the 4 types of sugars and why do we need them to function

A: Sugar is also called carbohydrate. There are four types of sugar namely, monosaccharide,…

Q: How can we control a protein's function/s?

A: The four structural stages that characterize the folding of protein are the primary secondary,…

Q: Your cells need to make more proteins!  In order to do that, you need the proper monomer nutrients.…

A: Enzymes are the substance formed from proteins that play important role in conversion of complex…