Which two of the following statements about transcription are true A. Transcription makes an RNA copy of a DNA template B. Transcription makes an RNA copy of an RNA template C. Transcription involves the addition of NTPS to the 3' end of a growing RNA chain D. Transcription involves the addition of NTPS to the 5' end of a growing RNA chain E. Transcription makes an DNA copy of an DNA template

Which two of the following statements about transcription are true A. Transcription makes an RNA copy of a DNA template B. Transcription makes an RNA copy of an RNA template C. Transcription involves the addition of NTPS to the 3' end of a growing RNA chain D. Transcription involves the addition of NTPS to the 5' end of a growing RNA chain E. Transcription makes an DNA copy of an DNA template

Name: Which two of the following statements about transcription are trueA.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which two of the following statements about transcription are trueA. Transcription makes an RNA copy of a DNA templateB. Transcription makes an RNA copy of an RNA templateC. Transcription involves the addition of NTPS to the 3' end of a growing RNA

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 8QP: The following segment of DNA codes for a protein. The uppercase letters represent exons. The...

See similar textbooks

Similar questions

Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Which of the following apply to transcription: Synthesis of a chromosome using DNA polymerase that produces two new chromosomes O Synthesis of a DNA molecule using RNA polymerase that produces multiple genes O Synthesis of a mRNA molecule using DNA polymerase that produces protein O Synthesis of a mRNA molecule using RNA polymerase that is a copy of a gene O Synthesis of a protein from a specific mRNA molecule that requires a ribosome
What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC (assume transcription is from left to right)? Indicate clearly the 5' and 3' ends of your transcript. 5'-GAUGUUUAC-3' 5'CUACAAAUG-3' 5'-CAUUUGUAG-3' 5'GUAAACAUC-3
In which order do the following events occur in prokaryotic transcription (from 1 = first to 4 = last)? The new RNA strand detaches from the DNA template and RNA polymerase RNA is synthesized in the 5' to 3' direction RNA polymerase reaches the termination site RNA polymerase complex binds to the promoter
The diagram below shows a section of double-stranded DNA undergoing both transcription and replication. RNA polymerase (gray oval) is bound to the transcriptional template strand and moving from left to right (arrow). The resulting RNA transcript is also shown (dotted line) with limited base pairing to the template strand. The DNA sequence is specified for a portion of the double-stranded DNA. IMAGE a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand (upper or lower) is the template for lagging strand synthesis c. Indicate the nucleotide sequence of the RNA that was transcribed from the DNA region specified by the sequence. Label the 5' and 3' ends of this sequence.
Which of the following are features of transcription? -there is a direct interaction between nucleotides in the template DNA strand and incoming nucleotides being joined at the growing end of the RNA chain. -the RNA product remains permanently hydrogen-bonded to the template DNA strand. -the RNA being produced is elongated by addition of nucleotides at its 5' end. -the template DNA strand is "read" by RNA polymerase in a 3'-to-5' direction. -the site at which transcription starts is called the replication origin. More than one answer is right Please help me I’m confused
In which direction does RNA polymerase elongate a strand of RNA? O 3' to 5' 5' to 3' Both 5' to 3' and 3' to 5' O It depends on which strand of DNA is being transcribed
ng sta statements about promoters that are true. A promoter specifies where RNA polymerase initiates transcription A promoter specifies which strand of DNA will be used as the template during transcription A promoter specifies where DNA polymerase initiates replication
Which strand of DNA is used by RNA polymerase during transcription? O Coding strand OLagging strand Leading strand Template strand O O O O
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Which of the following are involved in transcription? RNA polymerase DNA amino acids TRNA acetyl transferase MRNA FRNA O ribosome
The following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the MRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter U UUU UUC UCU UAU UGU Phe Tyr Cys UCC UCA UAC UAA STOP UAG STOP UGG| Trp UGC Ser UUA UGA STOP A UUG Leu UCG CUU CCU CC CAU CGU CGC His CUC C CUA CAC САА Leu Pro Arg CCA CGA Gln CUG СCG CAG CGG AGU Ser AAU AAC ACU AUU lle AUC Asn ACC ACA AGC Thr AAA AGA AUA AUG Met Arg ACG AAG Lys AGG GAU GCU GCC GUU GGU Asp GAC GGC GGA GUC Val Ala Gly GCA GCG GAA GAG GUA Glu GUG GGG Third letter UCAG UCAG 5CAG UCAG First letter