Which of the following pairings is FALSE? Question 34 options: Merkel cells = sensation of general sense of "touch" across most of the skin Lamellated (Pacinian) corpuscles sensation of heavy pressure, vibration Tactile (Meissner's) corpuscles = delication sense of touch (finger tips) Baroreceptors = sensation of fullness (stomach) All are correct pairings

Q: STR ⒸDigital Frog International A B

A: Introduction  The heart, blood vessels, and blood are all part of the blood circulatory system,…

Q: Use pay terms to explain Sandors injury and the treatment that was required

A: Alex Sandro, a Brazilian footballer, suffered from a sprained medial collateral ligament (MCL) of…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: بار در انبار الدولة ر

A: The ECG or electrocardiogram is a test that is used to detect the heart rhythm and electrical…

Q: A hepatocyte is infected with the Hepatitis C virus. It will use: O Exogenous antigen processing and…

A: The Major Histocompatibility Complex (MHC) is a gene family found in all vertebrates that codes for…

Q: C A E В Н I

A: Cell is the basic structural and functional unit of life. An animal cell contains a cell membrane,…

Q: Name please_

A: 1) Metzenbaum-Nelson curved scissors 2) Doyen's curved scissors  3) Curved artery forceps

Q: more?

A: Introduction :- Reflexes are innate, automatic, and rapid responses to specific stimuli that occur…

Q: What is TEE?

A: A transesophageal echocardiogram (TEE) is a type of echocardiogram test that is performed via the…

Q: Diarrhea prefix meaning

A: We know that Medical terminology  Terminology includes a group of words related to subject area. It…

Q: Well firm - limited smooth bulge on the hard palate of this 67 year old woman, painless so what is…

A: Introduction - Cancer is a broad term that describes a variety of disorders characterised by the…

Q: FAILURE TO THRIVE

A: Failure to thrive is a descriptive term and is not actually a diagnostic term. This term is used…

Q: What is the neuromuscularsynapse?

A: The neuromuscular junction is a site where, the axons and the muscle fibers communicate with each…

Q: HR VS Sem's O 150 005 Rhythm fifififif 1252, 20 jufifufuful

A: ECG states electrocardiogram. It is a non invasive diagnostic procedure. It is used to record the…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The cytoplasmic granule of RNA andprotein that reads the message in mRNA isa/an ____________________

A: The central dogma of molecular biology describes the flow of genetic information in cells from DNA…

Q: AND PANCREAS 8. 10 11

A: The duodenum is the first section of the small intestine in most higher vertebrates. The pancreas is…

Q: Thoughts on vaccinations

A: The use of vaccinations or vaccines is essential for suppressing the spread of infectious illnesses.…

Q: What about the references?

A: If we see around us there so much there to explore and learn. Science allows us to understand things…

Q: Fibrocartilage (____×)Location _______________________ Function _______________________

A: As we know human body is made of skeleton. Skeleton is structure that keeps body in shape and helps…

Q: What is  hypoventilation

A: Ventilation is a process of exchange or movement of air (gas) between the lungs and atmosphere…

Q: Which letter represents the corpus spongiosum? -B -D OD O A CDE

A: Introduction: The male reproductive system comprises the following: A pair of testis Accessory…

Q: Loss of heterozygosity of tumor suppressor gene_______________

A: Loss of heterozygosity -It is the loss of one parent's contribution to cell and can be caused by…

Q: 7nm= _ um= _ mm

A: 1 nano meter is equal to 0.001 or 1/1000 micrometer 1 micrometer is equal to 0.001 or 1/1000 milli…

Q: 100mL to ul

A:

Q: A,

A: Meosis is the type of cell division which resukts in the formation of the gamete.  In humans the…

Q: refferences

A: The Central Nervous System (CNS) is the part of the nervous system that includes the brain and the…

Q: leptin i

A: Erythropoetin is a hormone which is responsible for the production of RBC

Q: Label name correctly please answer

A: We know that The muscular system is formed by the muscles of the body that are soft tissues and are…

Q: Label A and B asap

A: We can say that Blood is a fluid tissue that transports oxygen and nutrients to all parts of the…

Q: The maln difference between Pictures A and B is that B uses while A does not.

A: The plasma membrane of the cell is a plasma lipid layer, which separates the cell interior from the…

Q: Questions: 1. Select a discrete colony. Describe the appearance of the colony. 2. Describe the…

A: The study of bacterial cultures is an interesting aspect of microbiology. It includes the cautious…

Q: A- Min

A: Muscles of forearm, wrist and hand are subdivided into 19 intrinsic and 24 extrinsic muscles. The…