Which of the following options correctly describes the result of the following C/C++ code? int a=6, b=9: int *ptr = &b; a = *ptr; O A. The value of variable a is changed to be the memory address of variable b. B. The value of variable b is changed to the value of variable a. O C. The value of pointer ptr is changed to be the memory address of variable a. O D. The value of variable a is changed to the value of variable b.

Which of the following options correctly describes the result of the following C/C++ code? int a=6, b=9: int ptr = &b; a = ptr; O A. The value of variable a is changed to be the memory address of variable b. B. The value of variable b is changed to the value of variable a. O C. The value of pointer ptr is changed to be the memory address of variable a. O D. The value of variable a is changed to the value of variable b.

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter10: Pointers

Section10.4: Passing Addresses

Problem 2E

See similar textbooks

Similar questions

question Write a c++ program that follows the program requirements below
Write nested for loops to print the following pattern, as shown in the picture.
Answer msut be in C++ Write a program that will manipulate a person's name. Write a program that passes three blank character arrays into a function, asks for the user's first, last and middle name and stores each in its own character array. Upon returning to the main program create a fourth array, maipulate and combine the three array values storing the user's name in the following manner: last name, followed by a comma and space, then the user's first name and middle initial only (followed by a period), separated by a space. For example, if your name is "Jill Saint John", the value stored in the fourth array should be "John, Jill S." Display the contents of the fourth array on the screen.
How may the address of a variable be added to a pointer variable? Why is the code below problematic?
The solution must be using pointer
Task related to pointers : Write a C++ program to find the max of an integral data set. The program will ask the user to input the number of data values in the set and each value . The program prints on screen a pointer that points to the max value. ( Drop code in words , explain the code and drop the screenshot of output as well )
Question 1a. What digits are used in the binary number system?b.What digits are used in the decimal number system?c.What digits are used in the octal number system?d.What digits are used in the hexadecimal number system? \ Question 2In the following program, there is a call to the print_in_reverse function whichhas the following prototype: void print_in_reverse(float *a, int count); Using pointers, write this function to print the array in reverse order. #include <stdio.h>#define A_SIZE(A) sizeof(A)/sizeof(A[0]) void print_in_reverse(float a[], int count);int main(void) { float values[6] = { 12.1F, 22.2F, 32.3F, 42.4F, 52.5F, 62.6F }; printf("The array in reverse\n"); print_in_reverse(values, A_SIZE(values)); return 0;} Question 3The program below reads two integers. Then a function with the followingprototype is called: void div_rem(int a,…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
program Credit Card Validator - Takes in a credit card number from a common credit card vendor (Visa, MasterCard, American Express, Discover) and validates it to make sure that it is a valid number (look into how credit cards use a checksum) - it's a C++ program so use #include <iostream> - And please use an array, use files, and use pointers in this program. -
Using C language and using pointers
Assume ptr is a pointer, the following expressions has the same values *&ptr and ptr? Select one: a. True b. False
Programming in C.