Which of the following is true regarding the human genome? SİRNA prevents LINE element expansion by either degrading LINE MRNA methylating LINE DNA DN A :
Q: Which of the following enzymes is mainly responsible for recognizing the PAM sequence in the…
A: CRISPR (clustered regularly interspaced short palindromic repeats) sequences are found in bacterial…
Q: What is the correct order of the gene sequence given the following information: BD - 14% CD - 12% AD…
A: BASIC INFORMATION ABOUT GENETIC MATERIAL DNA It stands for deoxyribo nucleic acid. It is the…
Q: Which of the following mobile genetic elements is a retrotransposon, making up about 15% of the…
A: A transposon may be a nucleic acid sequence which will modify its position among a genome,…
Q: Which of the following is a transition mutation? OG --> T G --> A G --> C
A:
Q: Which of the following enzymes is mainly responsible for recognizing the PAM sequence in the…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: The base composition of the genetic material is the same in all the species present on earth. The…
Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'
A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…
Q: Identify which mutagen is described by the following statement. Results to the formation of thymine…
A: Thymine dimer: a. It consists of two adjacent pyrimidine nucleotides, which are usually thymine…
Q: Which of the following is a mechanism to imprint genes? O A) Methylation of cytosine B)…
A: The epigenetic modifications involves DNA methylation. By this process the expression of genes…
Q: What molecules or structures are present in cell that might interfere with DNA extraction?
A: DNA extraction is a method used to purify DNA from a sample. Here seperation of DNA occur from…
Q: Which of the following types of mutations would be produced by repair of a CRISPR-targeted double…
A: Non Homologous End joining is described as the pathway required for the repairing of those double…
Q: What is the correct order of the gene sequence given the following information: AB - 13.2% BC - 6.4%…
A: Chromosomes contain genes. The order of genes is generally conserved in different organisms. The…
Q: Most of the eukaryotic genome consists of protein-coding genes Group of answer choices True False
A: It is composed of one or more linear DNA chromosomes. The amount of DNA varies from species to…
Q: All EXCEPT which of the following statements are evidence that DNA, and not protein, is the genetic…
A: In the past, it was known that organisms carry something that is passed on to subsequent…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: An enzyme produced from the bacteria which recognizes specific base sequence in DNA and cut the DNA…
Q: Which of the following is a transversion mutation Select 4 correct answer(s) OA --> T OC--> T C -->…
A: Point mutations The mutations that occur at single base nucleotides are called a base or point…
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…
A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…
Q: Which of the following process generates a new copy of the transposable element at a new location of…
A: Transposition is a DNA recombination reaction that results in the translocation of a discrete DNA…
Q: GENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'…
A: Introduction In most organisms, genetic material is stored in the form of DNA in every cell of the…
Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…
A: Since you have asked the multipart question, we will solve the first three questions for you. If you…
Q: ) Consider a reference genome with genes as follows: AGAGAGAG|AACAACAACAAC|GGGAAAGGGAAA gene 1 |…
A: In DNA sequencing, a read is considered as an inferred sequence of base pairs or base pair…
Q: The BLAST program begins with a particular genetic sequence anda. translates it into an amino acid…
A: Homologous genes have similar DNA sequences which emphasizes that the proteins encoded by these…
Q: Identify which mutagen is described by the following statement. Results to the deamination of…
A: Mutagens are substances that induces mutation. Chemical mutagens are certain chemicals that induces…
Q: Define the following terms: a. transfection b. replicative transposition c. composite transposition…
A: Note: Since you have posted a question with multiple subparts, we will solve the first three…
Q: What type of mutations are the most harmful to an organism? Select at least 2 answers Deletion…
A: Mutations are change produced in the structure of DNA. These changes can be introduced either due to…
Q: The picture below depicts an aberration in the process of genetic coding. Which of the following…
A: DNA replication is the process by which a new DNA is synthesized by using a parental DNA molecule.…
Q: Which of the following contain only the sequences required for transposition and the genes for…
A: Transposons are the DNA sequence which can change their position within the genome. It may be simple…
Q: A hereditary disease is inherited as an autosomal recessive trait. The wild-type allele of the…
A: Given Northern blot data:Wild type allele = 1250 nucleotides long and A 1020 nucleotide allele is…
Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…
A: Hi, Thanks For Your Question. Answer : Correct Option Is b (20%) Explanation : P (III-7 Is…
Q: Which of the following mobile genetic elements is a retrotransposon, making up about 10% of the…
A: A transposon can be defined as the characteristic mobile genetic element. These elements can…
Q: The process in which completely unmethylated DNA becomes methylated is called a. maintenance…
A: The silencing of gene expression in some plants and eukaryotes is done by an important event known…
Q: Which enzyme is required for the movement in DNA-only transposons? Group of answer choices Reverse…
A: In early 1970s, a number of researchers including Peter Starlinger and James Shapiro, independently…
Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…
A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…
Q: Which of the following statements can be said about the enzyme telomerase? Select all the answers…
A: The correct answers are : Option 2 Option 3 Option 4.
Q: What is the correct order of the gene sequence given the following information: AD - 25% AB - 15% AC…
A: Linkage map distance is calculated just as for the two point cross, by calculating the percentage of…
Q: The base composition of the transcribable DNA template is: A = 10% G = 40% C = 30% T= 20% %3D %3D…
A: Transcription is a process in which the information in a DNA template is copied to produce an mRNA.
Q: Which of the following endonuclease removes a length of DNA between two telomere sequences?a)…
A: Endonucleases are the restriction enzymes which make cuts at a specific positions within the DNA.…
Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…
A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…
Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…
A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…
Q: Repeated sequences can lead to many chromosomal rearrangements following of two repeats and (3…
A: Chromosomal rearrangements are alterations in the chromosome sequence which is majorly caused by…
Q: Which of the following mutagens results in the deamination of nitrogenous bases? O nitrous acid base…
A: The amino bases adenine and cytosine lose one amino group when they are oxidised. As a result, in…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: The guanine and adenine are purine bases. These are composed of 5 and 6 sided ring. Thymine and…
Q: Define the following terms: a. nonreplicative transposition b. transposable element c. bacterial…
A: Horizontal gene transfer or lateral gene transfer is a genetic transfer method by which the genetic…
Q: A vector that can carry a large fragment of chromosomal DNA is aa. YAC.b. BAC.c. PAC.d. any of the…
A: Vector is a deoxyribonucleic acid (DNA) segment and a genetic tool which, is used to carry sequences…
Q: single strand binding proteins are important for this activity prevent replication of the ends of…
A: Single strand binding protein (SSB) are a type of protein found in both viruses and microorganisms…
Q: If transmission of genetic information from cell to cell is normally achieved by copying the…
A: Introduction: Nucleic acids are one of the major molecules comprised of a nitrogenous base, a sugar…
Q: Outline natural processes that can produce mutationsby damaging DNA.
A: DNA damage refers to any damage in the chemical structure of the DNA molecule whereas the mutation…
Answer question 23
Step by step
Solved in 3 steps with 1 images
- Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'In relation to central dogma of molecular biology answer the following questions: The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect.
- Given the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letterGiven the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'oslorGulolaculGACu When does DNA replication occur in the cell cycle? Replicate this strand of DNA: ATTCGC TAG GU Aanine Transcribe the same piece of DNA Stop GU Valine Cystelne Stop Use the chart to create the amino acid sequence. Arginine AC Leucine Sorine C UG Lysine Proline Define gene mutation Asparagine True or False? All mutations are harmful. Define chromosomal mutation. Histidine Threonine
- A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids The section of a gene shown above (AAG ATA CAG GCT CGG TAA) is called the Answer (template or non-template) strand. It is also known as the Answer (sense or antisense) strand. The amino acids are determined from the Answer (DNA or mRNA or tRNA) strandIf the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginineThe following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GThe following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base pairs. How long would this DNA be?