Q: The pigments, energy reserve products, and cell walls found in land plants are also characteristic…
A: Introduction A cell wall is a structural layer found just outside the cell membrane that surrounds…
Q: Malaria (a) is transmitted by the bite of a female tsetse fly (b) is caused by a parasitic…
A: Malaria is a disease characterized by fever with chills and fatigue.
Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.
A: The term homeostasis was given by Canon (1960). It is the mechanism by which stable chemical and…
Q: Why are the protists considered paraphyletic?
A: A group is paraphyletic in taxonomy if it contains the group's latest common ancestor and the…
Q: at factors in a population would mean that the Hardy-Weinberg principle does not apply? Give an…
A: Natural selection is one type of adaptive evolution mechanism. It happens because organisms with…
Q: Which of the following hormones is NOT correctly matched to the event? Group of answer choices…
A: Hormones are our body's chemical messengers. They travel in your bloodstream to tissues or organs.…
Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…
A: 51. C. Ionising radiations 52. E. Frameshift mutagens 53. B- Nucleotide analog 54. A,. UV rays 55.…
Q: Interpret the data given in the table below. Explain your answer. (Flooding of transplanted wetland…
A: Weed management Weed management is an agricultural practice in which the effective measures to…
Q: Which of the following is a function of TRNA? O A) brings one amino acid to the ribosome B)…
A:
Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.
A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…
Q: Which of the following lists the three steps of translation in their proper sequence? O 1.…
A: Translation is defined as the process of protein synthesis. It takes place in the cytoplasm.
Q: What is the function of DNA helicase in DNA replication? to create an RNA primer to initiate DNA…
A: DNA polymerase plays a key role in new DNA synthesis. In eukaryotes, DNA polymerases can be…
Q: To explain: Why the cancer treatments cause hair to fall out.
A: Cancer is a well known that they're supposed to define that they are condition in which cells grow…
Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…
A: The answer is option D.8.7×10 power 6.
Q: In a tautomeric shift Multiple Choice it is always adenine that is changed. final bonding…
A: Nucleic acid bases exhibit keto-enol and amino-imino prototropic tautomerism due to the presence of…
Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…
A: The process of converting DNA instructions into proteins is known as the central Dogma.
Q: sketch the microscopic features of the genus asperigillus
A: Introduction :- A fungus is any member of a group of eukaryotic organisms that includes…
Q: What effect does the agricultural industry have on climate change
A: Disclaimer: “Since you have asked multiple questions, we will solve the first question for you. If…
Q: 14. Why is titin important with respect to muscle contraction?
A: Titin is a protein encoded by a TTN gene. It is the largest protein in human beings.
Q: What is the difference between the heart sounds of lupp and dupp?
A: Lub and dup are cardiac sounds that can be detected with a stethoscope placed on the chest just…
Q: The ability to taste the compound PTC is controlled by a dominant allele T, while individuals…
A: A trait is a characteristic features that is exhibited by particular individual . As per the…
Q: In order of progression, state the steps that would lead to the development of natural active…
A: Principle of Active Immunity: Humoral immunity is the mechanism by which your body develops…
Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…
A: A mutagen is a substance or agent that causes DNA damage, resulting in changes to the DNA sequence.…
Q: Which protein is NOT necessary to initiate DNA replication in E. coli? A. helicases
A: The biological process of making two identical DNA replicas from a single original DNA molecule is…
Q: Why do anisogamous organisms only experience the twofold cost of sex?
A: Anisogamous is defined as a mode of sexual reproduction in which fusing gametes, formed…
Q: Give some examples of plant macronutrients and their sources
A: Nutrients are categorized as macronutrients or micronutrients according to the amount required by…
Q: Explain the formation of tree rings.
A: Introduction :- A tree's girth grows each year, and the new growth is known as a tree ring. The…
Q: STRUCTURE STAINING IMPORTANT EVENTS OF DEVELOPMENT Proerythroblast Basophilic erythroblast…
A: There are few important points : Blood is a connective tissue composed of liquid extracellular…
Q: Helping tags: Biology, microbiology, outbreak, botulism WILL UPVOTE, just pls help me answer the…
A: Botulism is a condition that affects the nerve system and can be lethal. Toxic compounds called…
Q: cribe in detail the mechanism of action of memantine in the treatment of Alzheimer’s Disease.
A: Alzheimer's disease is defined as a medical condition in which an individual finds it difficult to…
Q: Explain how endodermis helps control the amounts and types ofsubstances that enter xylem.
A: Xylem is the tissue in plants that transports water and nutrients from the roots to the rest of the…
Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…
A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…
Q: Water molds reproduce asexually by forming _______________ and sexually by forming _______________.…
A: Introduction :- Oomycetes (a term for creatures in the phylum Oomycota) are a fungus-like group of…
Q: Oestrogen, follicle-stimulating hormone (FSH) and luteinising hormone (LH) works together to…
A: The endocrine system collaborates with the neurological system to keep the body in a state of…
Q: In chymotrypsin the active site histidine Oa. Forms a tetrahedral intermediate O b. Acts as a proton…
A: Introduction Chymotrypsin is a digestive enzyme that belongs to the serine proteases superfamily. It…
Q: major life zones characterized by vegetation and climate, primanly average temperature and…
A: Tropical regions contain tropical forest. These are characterized by hot temperatures all the year…
Q: Question 44 1 pts Reactants capable of interacting to form products in a chemical reaction must…
A: Activation energy is defined as the minimum amount of extra energy required by a reacting molecule…
Q: Why do anisogamous organisms only experience the twofold cost of sex?
A: Isogamous sexual reproduction occurs when male and female gametes have similar morphology. They are…
Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…
A: The genetic material in majority of complex higher organisms and various viruses is DNA or…
Q: Although this group has the least number of identified and classified species, its diversity is…
A: Animals are diverse and are classified based on their shape, size, morphology, eating habits, and…
Q: phylogenetic tree according the the island: 1) Anolis sheplani 2) Anolis cybotes 3) Anolis olssoni…
A: Phylogenetic tree A phylogenetic tree is an evolutionary tree that depicts the evolutionary…
Q: Which is true regarding Herpesviridae? Select all that apply. ( Measles in an example O HSV-1 is an…
A: Herpesviridae is a large family of DNA viruses. It includes HSV1 and HSV2.
Q: O A) the nitrogenous base and the first phosphate group O B) the ribose sugar and the nitrogenous…
A: INTRODUCTION ATP (adenosine triphosphate) is an energy-carrying molecule found in the cells of…
Q: Sample A has been allowed to breed randomly for many generations. At a particular gene locus, there…
A: Population A is in Hardy-Weinberg Equilibrium. That means the sum of the frequency of two alleles is…
Q: Which steps are part of the energy investing half of glycolysis? Phosphorylation Isomerization…
A: Here i will discuss the steps involved in energy investment during glycolysis.
Q: PROTEINS NUCLEIC ACIDS
A: Proteins serve a variety of purposes, such functioning as enzymes and hormones, regulating fluid and…
Q: A plant that grows very close to the ground, tends to be small in size, favors moist environments…
A: Given: Plants are the primary source of nutrients for all living organisms. Plants take sunlight for…
Q: Identify the correct group of helminth with sizes of eggs listed from largest to smallest. O…
A: Helminths These are the parasitic worms that can be observed by the naked eye when they are in the…
Q: ELEMENTS MACROMOLECULE FUNCTION MONOMER POLYMER EXAMPLE(S) CONTAINED CARBOHYDRATES LIPIDS
A: Carbohydrates supply energy to the body, which is one of their key purposes. Before reaching the…
Q: Proteus vulgaris is positive for the production of the enzyme phenylalanine whereas Escherichia coli…
A: INTRODUCTION Proteus vulgaris is a Gram-negative, rod-shaped, nitrate-reducing, indole-positive, and…
![Which of the following is NOT true of Aspergillosis?
it is a zoonosis
O it may cause serious lung infections that mimics TB
it may disseminate to the brain in transplant patients
O it is an opportunist but infects immunocompromised patients with serious disease](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F9b28ad6d-1cf8-4e89-819f-4b73f6b7ef6f%2F2d345bbc-4c14-4d32-b0d3-4cb5ab266318%2F1livwy_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Which of the following is NOT true of bacterial exotoxins? 1. Important in the pathogenesis of many human diseases 2. Their toxic effect can be systemic, affecting cells distant from the primary site of infection 3. None of the other four answers (All are true of bacterial exotoxins) 4. Different exotoxins may affect different types of cells (e.g., nerves, gastrointestinal mucosa) 5. Some exotoxins have two components, A (active) and B (binding)Most common symptoms of Lupus ret th Lupus is difficult to diagnose because symptoms come and go with the disease. Here's how frequently various symptoms occur. di ob Percentage of Patients Who Experience It in Symptom 95% Achy joints Fever over 100 degrees 90% 90% Arthritis (swollen joints) Prolonged of extreme fatigue 81% Skin rashes 74% Anemia 71% 50% Kidney involvement Chest pain on deep breathing 08 45% 42% alaxe Butterfly-shaped rash across cheeks and nose oni30% .C8 or p Hair Loss nsAbnormal blood clotting problems Sun or light sensitivity iso enw9 27% 6 pi 20% iloe eb17% Raynaud's phenomenon (fingers turn white or blue in cold) Seizures 15% Mouth or nose ulcers 12% Source: Lupus Foundation of America, Daily Herald, December 20, 1999 31. Systemic lupus erythematosus, or lupus, affects a few million people in the United States. Most of these people are young women. Lupus is a chronic, autoimmune disease that affects connective tissue in any part of the body. An attack can damage…Which term would best describe the occurrence of a disease that is not normally seen, yet occasionally a case will occur, such as tetanus? 1) endemic O 2) sporadic 3) epidemic O 4) pandemic
- All the following about Poliomyelitis 1 point are correct except Humans are the only natural host. symptomatic and minor infections which can be called abortive poliomyelitis O Almost been eradicated worldwide O paralytogenicToxoplasmosis is caused by O Toxoplasma gondii and it can only be transmitted when eating soil. Toxoplasma gondii and horses are one of the main carriers of it in the US. Toxoplasma gondii and cats are one of the main carriers of it in the US. O Toxoplasma gondii and it does not exist in the US.E. histolytica and G. lamblia both infect which organ system? None of the listed answers are correct. O Integumentary O Gastrointestinal Circulatory O Respiratory
- Which of the following is NOT true about human plague (Yersinia pestis infection)? Which option is the answer? 1. None of the other four answers (All are true about human plague) 2. Infected fleas’ gastrointestinal tract is blocked by Y. pestis growth, causing them to regurgitate and infect a new host when they bite 3. Painful swollen lymph nodes are called “buboes” 4. Usually acquired in the US from bites of fleas that have fed on infected urban rats 5. Yersinia pestis infection of lymph nodes can sometimes spread to the lungs, causing secondary pneumonic plagueA patient arrives at the hospital and is in severe pain. However, after evaluation it appears as though their pain level is disproportionate to the appearance of the wound. What is a potential diagnosis and causative organism? . O Necrotizing fasciitis which is commonly caused by S. epidermidis O Staphylococcal scalded skin syndrome which is caused by S. aureus O Necrotizing fasciitis which is commonly caused by S. pyogenes O Impetigo which is caused by S. pyogenes Question 17 What is the role of cord factor? O Cord factor inhibits the movement of cilia in the respiratory system O Cord factor blocks the release of bacterial endotoxins O Cord factor stops neutrophil migration O Cord factor releases fibrin and captures monocytes Question 18 Cvanosis is a common sign for which pathogenic organism? 12Why would medication fail to cure HSV infections even though it prevents recurrent cold sores?
- The swelling of limbs typical of elephantiasis is due toa. allergic reaction to the filarial wormb. granuloma development due to inflammation by parasitesc. lymphatic circulation being blocked by filarial wormd. heart and liver failure due to infectionWhich of the following statements about anthrax is incorrect? there is a potential for long-term memory damage in survivors O the organism produces a 3-component toxin O transmission of this disease is by spores and it is not considered contagious O some strains of anthrax cause the inhalation form, while others cause the cutaneous form antibiotic therapy must be given early for effective treatmentWatch Video: https://www.youtube.com/watch?v=DueeDf9Uprg In addition to food, Norovirus is spread via aerosols and contact transmission. What is meant by this description? Can you think of environments in which Norovirus is especially worrisome?
![Comprehensive Medical Assisting: Administrative a…](https://www.bartleby.com/isbn_cover_images/9781305964792/9781305964792_smallCoverImage.gif)
![Microbiology for Surgical Technologists (MindTap …](https://www.bartleby.com/isbn_cover_images/9781111306663/9781111306663_smallCoverImage.gif)
![Comprehensive Medical Assisting: Administrative a…](https://www.bartleby.com/isbn_cover_images/9781305964792/9781305964792_smallCoverImage.gif)
![Microbiology for Surgical Technologists (MindTap …](https://www.bartleby.com/isbn_cover_images/9781111306663/9781111306663_smallCoverImage.gif)