Which of the following describes the effect of a frameshift mutations? *   A. all mRNA codons change   B. some, but not all , mRNA codons change   C. there is no change in mRNA codons   D. no correct response Consider the following DNA base sequence 3' TTA ATA 5'. what dipeptide is formed if a DNA point mutation converts ATA to ATG? *   A. Cys-Phe   B. Tyr-Tyr   C. Phe-Leu   D. Ser-Tyr Consider the following mRNA base sequence 5' ACC CAC 3', what dipeptide is formed if a point mutation converts ACC to ACU? *   A. Thr-His   B. Thr-Thr   C. His- Ile   D. Ile- Asp Which of the following statements below is incorrect? *   A. the genetic code is overlapping   B. the genetic code is universal   C. degenerate codon specify the same amino acids   D. the genetic code is triplet Which protein can break covalent bond? *   A. Helicase   B. Primase   C. SSB   D. DNA gyras

Q: 63. A student studying mutations found her amino acid chain was…

A: Genetic information is carried by genes to make proteins .  Process includes:-  I ) Transcription II…

Q: Although the specific mechanism of RNA interference has not been fully defined, it involves A. the…

A: The RNA interference works at the post transcriptional level because it occurs after the synthesis…

Q: What happens when EF-Tu is mutated A. Be involved in transcription instead of translation B.…

A:

Q: Which of the following RNA molecules is to the sequence: 5' AGGCTCAAGCGT - 3'? complementary O a.…

A: RNA is a single stranded nucleic acid which plays a key role in gene expression and protein…

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the…

A: Mutation results in alteration of a nucleotide sequence of DNA which caused due to the mistake in…

Q: Formation of the 70S ribosomal initiation complex for prokaryotic translation requires A. Mn2+ B.…

A: The production of proteins made up of amino acids is a step in the translation process in cells.…

Q: According to the adaptor hypothesis, is each the following statementstrue or false?A. The sequence…

A: Introduction: According to the adaptor hypothesis, the RNA molecules would be connectors that could…

Q: Can you explain it?

A: Gene expression is a process where genes code for proteins which in turn results in function of the…

Q: During elongation (in transcription), RNA polymerase has three prominent channels, or grooves. These…

A: Gene expression is the process by which information from a gene is used in the synthesis of a…

Q: In the image, arginine 79 is shown to be important for the stabilisation of the quaternary protein…

A: Introduction  Amino acids are the building blocks of proteins. They are organic compounds composed…

Q: + + T | + + 1 = + T +||| + 2 +11 + 1 + + 1 + + + 1 + + + + 3 4 5 + + I 9 9 5 U 4 m N 1 + - - + + + +…

A: Given here are point mutattions and the correct order is as follows.

Q: The E site on the ribosome is

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Mutation of which of these sequences would have an effect on translational initiation?   A. 3’ UTR…

A: Introduction  Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most…

A: Mutation is defined as the change in the DNA sequence. This can occur either during the DNA copying…

Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…

A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…

Q: A peptide is produced in two different cells. The primary structure is the same in both cells, but…

A: Polyadenylation:Increases the stability of the mRNAIt is essential for translational…

Q: aminoacyl-tRNA

A: 43 D third position   The wobble position of a codon refers to the 3rd nucleotide in a…

Q: A mutation occurs that alters the third base in an mRNA codon from a C to a G. This mutation is most…

A: Introduction : A change in the sequence of DNA due to damage to the DNA or some other factors, which…

Q: o If the conserved -35 and -10 sequences found in a Prokaryotic promoter are moved 20 nucleotides…

A: Transcription is the process by which the information stored in DNA is transcribed into RNA. It is…

Q: Which of the following makes alternative RNA splicing possible? Group of answer choices A. Parts of…

A: Option A

Q: Which of the following mutations is likely to be the least harmful? A. A +1 frameshift mutation B.…

A: ANSWER;-  B). A +3 frameshift mutation Explain;- A frameshift mutation is a type of mutation…

Q: The enzyme Aminoacyl tRNA synthetase

A:

Q: To which part of DNA do the eukaryotic transcription factors bind? O a. promoter regions O b.…

A: Transcription is the synthesis of RNA from DNA that is the process of copying the information of a…

Q: Now the gene sequence was changed in a different way, such that instead of producing a mRNA with the…

A: Mutations are abrupt changes in the DNA sequence that may or may not change the amino acid sequence…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: mRNA is the type of RNA that gets translated. A. True  b. False    Transcription forms new…

A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. The DNA is passed on from one…

Q: A missense mutation is a mutation in which: a. one nucleotide in a codon is changed, but the codon…

A:

Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…

A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: What would happen if a lysine residue that was normally acetylated was mutated to an arginine?  A.…

A: Lysine acetylation occurs in the eukaryotic and prokaryotic organisms and it mutates thousands of…

Q: A SNV mutation that results in no change in the amino acid sequence is called:  A. silent mutation…

A: A mutation is a permanent alteration in the DNA sequence of an organism's genome. DNA, or…

Q: In addition to variable sites, the strucutre of a tRNA includes

A: tRNA tRNA or transfer RNA, sometimes referred as sRNA, is a adapter molecule which read the codon…

Q: In which site(s) of the ribosome could you find a tRNA with more than one amino acid bound (a…

A: Introduction :- The peptidyl transferase is an aminoacyltransferase and the principal enzymatic…

Q: How is the splicing of U2-dependent introns different from that of U12-dependent introns? O a.…

A: The non-coding sequences are called introns and hence are needed to be removed from RNA. This is…

Q: The point value of problems is given in braci number utilizes the enzyme a. Anticodon b. Polymerase…

A: Answers :- 1)RNA is synthesized on a DNA template in a process called transcription , which utilizes…

Q: Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation.…

A: Answer :- 1. UGU (Cys) is converted to UGC (Cys) - silent mutation

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: Transcription in prokaryotes produces mRNA that is ready to translate, while in eukaryotes the RNA…

A: Transcription is a proces of synthesis of RNA from DNA.During transcription;only one of the strand…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…

A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…

Q: Give typing answer with explanation and conclusion to all parts  The pairing of the U1 snurp and…

A: The splicing process is highly regulated and involves a numerous proteins and RNA molecules to…

Q: The anticodon of a tRNA is located in the a. 3′ single-stranded region of the acceptor stem. b. loop…

A: Transcription is a process in which the nucleotide sequences of a gene are transcribed into the RNA…

Q: The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.