Which memory location is used to store the return value when a C function returns a 32-bit integer?
Q: Create a tree prefix and postfix for the formula: (A (B + C) * D) / C 5.
A:
Q: Could you please explain the distinction between Harvard computer architecture and von Neumann…
A: Introduction: THE DIFFERENCE BETWEEN CON HUMANE COMPUTER ARCHITECTURE AND HARVARD COMPUTER…
Q: External Entities may be a
A: External entities is used to define and understand the sources and destinations of information…
Q: In what situations do database phones come in handy?
A: Introduction: It is a collection of organized data that can be readily accessed, managed, and…
Q: Linux tar - czf tgz./ why use > tor -txf why use > opt seorch youtube why don't why head! Commond
A: The Linux ‘tar’ stands for tape archive, is used to create Archive and extract the Archive files. Z…
Q: What do you mean by subnet mask?
A: A subnet mask helps in separating an IP address into network and host address.
Q: What is the importance of linux partitioning?
A: Solution: It allows us to divide our hard drive into isolated sections, where each section behaves…
Q: Please provide a detailed explanation of how hybrid cloud platforms, such as Dropbox, function.
A: The Answer is in step2
Q: What are the potential benefits of an enterprise data model for Mercy? Is Mercy's foray into big…
A: Introduction: Mercy is a health-care organization with 46 acute-care and specialty hospitals as well…
Q: Provide five suggestions for how a system designer can reduce the user's memory load.
A: DESIGNER OF SYSTEMS: System designers are the people in charge of developing the documentation for a…
Q: What is the purpose of shell scripts, please explain. Give an example of how variables,…
A: Shell scripts are used for the following purposes: A shell script is a text file that contains a…
Q: Write a java program to check if a list of integers contains only odd number. Please do it using…
A: I have provided JAVA CODE along with CODE SCREENSHOT and 2 OUTPUT SCREENSHOTS-------------
Q: A- System.out.print(Math.floor(5.7)); Answer please
A: System.out.print(Math.floor(5.7));
Q: We will ask you and your classmates to write on the whiteboard the number of kids your immediate…
A: Python code: f=open("n_kids.txt","r")l=[]while f: n=f.readline() if(n==""): break…
Q: Explain the different collaboration tools available and how they may be used to improve project…
A: Technology for Collaboration: Collaborative technology is a term that refers to tools and systems…
Q: Write a C++ program that contain a menu rto call user defined functions on a one dimendional array:…
A: Given, 1- fill the array with integers >20 2- print the content of the array 3- find all perfect…
Q: Why are there so many different partitioning algorithms in use by operating systems, and why are…
A: given- Above question answer is given below
Q: ing lemma to check if the following languages are "regular" or "not regular". Show your complete…
A: Given: L = { w ε {0,1}* :w = 0*(10*)* } Note: A language is regular if and only if it is recognized…
Q: How do you know whether a system component should be a source or a sink? or as a method?
A: The system's sources and sinks are external.The origin and/or destination of data are referred to as…
Q: What is open source in computer science?
A: Foundation This question comes from Internet Technologies which is a paper of computer science.…
Q: Explain the naming convention for data-flow diagrams' various layers.
A: Introduction: In DFD, there are several name conventions for various levels. Different processes,…
Q: What is the difference between data, information, and knowledge, and can you give me some instances…
A: Introduction: The simplest form of data consists of a collection of alphanumeric values. Information…
Q: Which conditional jump instruction is the JNA instruction's equivalent?
A: JNA - Jump if not above instruction The JNA instruction is a jump instruction that, depending on the…
Q: create a truth table that will accpet 2-bits as input (A,B) and will generate the square of the…
A: Here in a 2 bit number, the highest possible integer value is 3 Square of 3 is 9 . The output 9…
Q: Explain in fully the notion of cloud computing, including the advantages of using it.
A: answer is
Q: Is it possible to include a try block and its associated catch blocks inside a larger catch block?
A: Introduction: Is it possible to include a try block and its associated catch blocks within a giant…
Q: Explain the different collaboration tools available and how they may be used to improve project…
A: Introduction: The number of collaboration tools has grown in recent years. What began as shared…
Q: :the output of (Print "a", "b", "c") is abc O ab c C abc O
A: Option C: a b c
Q: 1. Suppose A, B, C, D, E, F, G and H are 8 items and suppose they are assigned weights as follows:…
A: ***As per guidelines only 1st question is answered. For other questions please post separate…
Q: In what cases would you advocate the use of assembly language code in the creation of application…
A: The Answer is in Below Steps
Q: What exactly do I need to know about computer science?
A: Answer the above questions are as follows:
Q: Ensure that data transfer is distortion free, error detection and correction mechanism are required.…
A: Hamming Code Hamming code is a square code that is equipped for recognizing up to two synchronous…
Q: A- System.out.print(Math.floor(5.7); Answer please
A: Here in the given code, we have a print statement. In this statement, we have used the floor()…
Q: Please provide a detailed explanation of how hybrid cloud pla Dronhoy function
A: A hybrid cloud system combines public and private cloud computing.
Q: When it comes to service-oriented computing, what are the advantages and disadvantages?
A: Service oriented computing or the architecture is a kind of software design, where the services are…
Q: Explain the naming convention for data-flow diagrams' various layers.
A: Introduction: Each process must be given a unique name and have distinct inputs and outputs. Each…
Q: Solve problem by us ing PYTHON Program to remove the ith occurrence of the given word in list where…
A: Create a python program to delete the Nth occurrence of a word from the python list. First, read a…
Q: Which conditional jump instruction is the JNA instruction's equivalent?
A: JNA - Jump if not above instruction JNA instruction is a jump instruction that transfers the…
Q: Provide five suggestions for how a system designer can reduce the user's memory load.
A: INTRODUCTION: MEMORY: Memory refers to how information is acquired, stored, retained, and later…
Q: B. Construct the mathematical statement of the following. (8-14) •P = "JR comes to the party" •Q =…
A: Solution: CK comes only if KL comes means S->R. This implies either 1st option is correct or the…
Q: Identify the features and benefits of cloud computing and Network as a Service (NaaS).
A: Identify the features and benefits of cloud computing and Network as a Service (NaaS).
Q: Using the diagram 1) label the diagram and make a truth table 2) What fundamental gate is shown?
A: 1) Truth Table: A B A' B' A'+B' 0 0 1 1 1 0 1 1 0 1 1 0 0 1 1 1 1 0 0 0
Q: What exactly do I need to know about computer science?
A: Solution: First of all we need to know the basics of a a computer ,i.e, hardware parts and software…
Q: Assume the following JavaScript program was interpreted: Main calls fun2, fun2 calls fun3, fun3…
A: Fun1() can access variables a, b, c, d here b,c,d are local variables. Fun2() will access variables…
Q: Which conditional jump instruction is the JNA instruction's equivalent?
A: Introduction: Instructions for Unconditional Jumping Instructions for Conditional Jumping.…
Q: If you wanted to know the position of the letter v (i.e. return 2) in the String str containing the…
A: Java has an inbuilt function of indexOf which will return the position of a particular character…
Q: - System.out.print(Math.floor(5.7);
A: Below the output of function
Q: How does SETI operate in the context of cloud computing?
A: What is SETI? Since the early 1990s, a global team of scientists has been conducting SETI, or Search…
Q: Write a java code to get the number of electrons passing through a heater wire in one minute, if it…
A: Your Java program is given below as you required with an output.
Q: What will be the impact of the internet of things (IloT) on our everyday lives? Justify your…
A: Introduction: IoT is a network of networked, internet-connected devices that can gather and transmit…
Which memory location is used to store the return value when a C function returns a 32-bit integer?
Step by step
Solved in 2 steps
- When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error messagein C++: Given a decimal number, your code must convert the decimal number into binary, and insert the three necessary check bits that validate it as being correctly assembled and received. Please display the following results: -1 The Original Decimal Number -2 The Correct Form of the resulting Hamming Code 1: 15 2: 7 3: 12 4: 2 5: 6Define the function: int power (int base, int exp); It accepts the arguments for base and exponent and returns power. The algorithm is to repeatedly multiply the value of the base to how many times the value of exponent. Test the function inside main(). Write the complete program. Use C language. For example: Input Result 2 5 32 3 4 81
- Language: C Write the definition of the function bool odd (unsigned char data); which checks is the value passed to the function is odd or not by returning true or false, respec- tively. The function has to use bitwise operators and is not allowed to use arithmetic operators.C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Define the function: int power (int base, int exp) {/*It accepts the arguments for base and exponent and returns power. The algorithm is to repeatedly multiply the value of the base to how many times the value of exponent. Test the function inside main(). Write the complete C program. */} For example: Intput. Result 2 32 5
- Q- Write a program which defines three integer variables, var1, var2 and var3, & initializing them to the values 100, 200 & 300, it then prints out their addresses. Subject: C++select the correct answer that describes the C++ statement Q/ int *ptr = &x; cout << * ptr; Ans/ 1/ print the address of the pointer variable ptr on the screen 2/ print the address stored in ptr on the screen 3/ print the address of x on the screen 4/ print the value pointed by ptr on the screen3. Odd-Even-inatorby CodeChum Admin My friends are geeking out with this new device I invented. It checks if a number is even or odd! ? Do you want to try it out? Instructions: In the code editor, you are provided with a function that checks whether a number is even or odd.Your task is to ask the user for the number of integer, n, they want to input and then the actual n number values. For each of the number, check whether it is even or odd using the function provided for you.Make sure to print the correct, required message.Input 1. Integer n 2. N integer values Output Enter n: 5Enter value #1: 33 is oddEnter value #2: 66 is evenEnter value #3: 44 is evenEnter value #4: 11 is oddEnter value #5: 33 is odd