Which function is used to check whether a character is an alphabet? a) isalpha() b) isalnum() c) isdigit() d) isblank
Q: void change( int a[]) , the compiler converts the parameter to: Select one: a. int *const a b. int…
A: The compiler changes void change(int a[]) silently to void change(int *const a) at the time of…
Q: Programming Language : R programming (R Studio) A twin prime is a prime that has a prime gap of…
A: Introduction Prime Number: A prime number is a positive integer higher than one with no decimal…
Q: short answers : c)Give an example of a common floating point arithmetic error due to the particular…
A: an example of a common floating-point arithmetic error due to the particular way in which…
Q: C++ Code: DNA Sequence The main() function is already written for you. You will implement the…
A: 1. Include necessary libraries: - `iostream`: for input and output operations. - `string`: for…
Q: Write a program that will manipulate a person's name. Write a program that passes three blank…
A: Please find the answer below :
Q: Please fill in the blanks for C /*This task creates a program that reads 3 lowercase strings and…
A: Please find the answer below :
Q: Identify errors from the following C++ code: i) int A; a = 12>5 && 6=5; y=9; x = y; y = x; cout…
A: (i) int A; a=12>5 && 6<9; cout<<A; return 0; Error in line 2nd it…
Q: What is a recursive function? (A) A function that calls other functions B A function that uses a…
A: Given To know about the recursive function.
Q: strlen(); function returns:
A: option (b) is correct option
Q: Write a function that takes as argument an array of integers and the size of the array and returns…
A: The question asks for a C++ function that takes an array of integers and its size as input and…
Q: Lab 1 Angel Porter (Global Scope) O main0 B//Name //Date Due //cosc 112.105 [I/Lab 1 3 4.…
A: use loop to print * pattern use cout statement to print the message. end.
Q: Data Structures the hasBalancedParentheses () method. Note: this can be done both iteratively or…
A: NOTE: Only function is provided as per the question, and not the complete code. c++ function code:…
Q: Write a machine language program to input two one-digit numbers, add them, and output the one-digit…
A: Lets discuss the solution in the next steps
Q: Output differs. See highlights below. Special character legend Input Your output Expected output 5…
A: As you mentioned above output is not matched.So as per the information given:-We have to follow the…
Q: a- Write a C++ function that determines how many words in a string and use to find how many "C++"…
A: There are many languages which are used in today's wold. Computer language can be described as a…
Q: Create a program that converts the given number in the binary system to the decimal system . A…
A: Answer is
Q: Find the maximum number for (m=10, n =5 , k= 62) use suitable library function order.(the max…
A: According to the question, We have to find the maximum number for the value of m,n and k. m,n and k…
Q: The _____ function can append a C-String to another C-String. A) strcat() B) atoi() C) strlen()…
A: C language does not have a string data type. In order to create and use string, it must be stored as…
Q: C++ Take a character array then find the whole string using merging each character. You can take…
A: Requirements :- C++ Take a character array then find the whole string using merging each character.…
Q: Create a c program that will convert number figures into words 1. You can use user-defined…
A: C programming language is a basic programming language, It's easy to learn to program for beginners…
Q: C++ Code: This function will print out the information that has been previously read (using the…
A: In the context of bioinformatics, it's often necessary to analyze a given DNA sequence to identify…
Q: Write a python program with two functions/modules that does the following: .main() accepts input and…
A: Algorithm: Define a function called 'num_Test()' that takes an input string as its argument. Within…
Q: C Programming Write function checkHorizontal to count how many discs of the opposing player would…
A: Step 1: Define function checkHorizontal(). Initialize flank to 0 and count to 0. Step 2: Check…
Q: C++ A matrix is a rectangular array of numbers that is arranged in a two-dimensional table.…
A: Algorithm: The algorithm for finding the inverse of a 2x2 matrix is as follows: Input a 2x2 matrix…
Q: ucfirst(); function: O a. converts all leters into upper case O b. converts first letter into…
A: I have given an answer in step 2.
Q: enum greekTOMe {ALPHA, BETA, GAMMA, DELTA, EPSILON}; int a4[5] = (5, 8, 9, 22, 16}; a4 [ALPHA] =…
A: /*Program to demonstrate enum and array */ //include standard header#include <iostream>using…
Q: MATCH OUTPUT WITH QUESTION OUTPUT AS IT IS --------------------------------------------- Write a…
A: C++ program to solve the given problem is below.
Q: C++ coding question. Thank you for the help, I will upvote! Write a function, CharLength, that…
A: Here is the c++ code. See below step
C++
Which function is used to check whether a character is an alphabet?
a) isalpha()
b) isalnum()
c) isdigit()
d) isblank()
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Answer in C++Write a function recursively_count_vowels() which accepts a pointer to a string, and any other parameters you see fit, and recursively counts the number of vowels in the provided string. This function should return the number of vowels in the string. (programming language c)(Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?
- (Numerical) Write a program that tests the effectiveness of the rand() library function. Start by initializing 10 counters to 0, and then generate a large number of pseudorandom integers between 0 and 9. Each time a 0 occurs, increment the variable you have designated as the zero counter; when a 1 occurs, increment the counter variable that’s keeping count of the 1s that occur; and so on. Finally, display the number of 0s, 1s, 2s, and so on that occurred and the percentage of the time they occurred.C++CODE USING C++ 1. Undercover Mission Plan by CodeChum Admin Hi Programmer, I'm Agent J. I'm preparing for an undercover mission going to the enemy's base. However, it seems that my plans are still missing some few details. Can you help me with this? Instructions: In the code editor, there's a main() function that calls the recursive printPlan() function. The printPlan() function already contains some code but it seems to be missing a base case that makes it stop. Supposedly, this printPlan() function should only print the plan by n / 2 number of times. For example, if n is 10, then this should only print the plan 5 times or if n is 20, then this should only print the plan 10 times. Fix this function by adding the correct condition in its base case. For this problem, assume that the value of n is always divisible by 2. Input 1. Value of n Output Enter n: 6 Plan by Agent J. Plan by Agent J. Plan by Agent J.
- What is a recursive function? (A) A function that calls other functions B) A function that uses a while statement C) A function that calls itself (D) A function that uses conditional statementsC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…C++ Programming. Theme: Standard string manipulation functions - string concatenation, comparison, character search, string search, replacement and deletion. Task : Given a line(string) of type String . Write a program that arranges its elements in an array of type char A in alphabetical order and in an array of type byte B in ascending order.
![C++ for Engineers and Scientists](https://www.bartleby.com/isbn_cover_images/9781133187844/9781133187844_smallCoverImage.gif)
![C++ for Engineers and Scientists](https://www.bartleby.com/isbn_cover_images/9781133187844/9781133187844_smallCoverImage.gif)