RNA primaseDNA ligaseHelicaseDNA polymeraseSickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Which enzyme is used by the bottom daughter strand but not by the topdaughter strand? *RNA primaseDNA ligaseDDIVA CY DOLICY

Name: RNA primaseDNA ligaseHelicaseDNA polymeraseSickle-cell hemoglobin dif
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: RNA primaseDNA ligaseHelicaseDNA polymeraseSickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Which enzyme is used by the bottom daughter strand but not by the topdaughter strand? *RNA primaseDNA ligaseDDIVA CY DOLICY

DNA replication is the process by which a Double stranded DNA gets separated into two strands, and…

Answered: Which enzyme is used by the bottom…

Science

Biology

Which enzyme is used by the bottom daughter strand but not by the top daughter strand? *

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 1SQ: A chromosome contains many different genes that are transcribed into different ___ . a. proteins b....

See similar textbooks

Similar questions

This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the strand (which one?) . Show the RNA sequence from 5’ to 3’ direction. Then translate the RNA sequence into protein sequence using the genetic code table. 5’AGGGTCCAC 3’
Explain why H is 5' and leading strand and E is 3' and laggin strand.
What is the difference between DNA proofreading and DNA repair? In 3-4 sentence
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
Complete the complementary stand of the DNA shown Complementary strand стАG GTACT CAC G
If a cell has trouble unwinding the DNA and relieving strain far ahead of the replication fork, in which of the following genes is there a mutation? Beve reverse transcriptase O gyrases/topoisomerases O single stranded binding proteins O ligase O helicase
Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates to the 3' OH of the growing daughter strand in the 5' - 3' direction? Ligase Polymerase Topoisomerase Primase
The original wild-type" DNA strand is: 5'-ATGGGACTAGATACC-3'. Which allele is least likely to show a mutant phenotype? First letter A U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala 5'-ATGGGATAGATACC-3' ● 5'-ATGGGTCTAGATACC-3' O 5'-ATGCGACTAGATACC-3' O 5'-ATGGGACTAGTTACC-3' CAU CAC CAA CAG UAU Tyr UAC UAA Stop UAG Stop UGG Trp AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu UGU UGC Cys UGA Stop A CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg DOAG JOAG DO AO | DOA Third letter Gly C G
Give typing answer with explanation and conclusion
Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly