What would happen if an intron wasn't taken out before translation? And are there

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA…

A: The process in which eukaryotic ribosome selects its start codon is a part of translation.…

Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…

A: Information in the gene tell the cell to make a particular protein. This information is encoded in…

Q: Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid…

A: The introns are the non-coding parts of the premature mRNA that must be removed by…

Q: Will an insertion or a deletion of three nucleotides result in a frameshift mutation? Explain why or…

A: The frameshift mutation is the mutation by which the amino acid frame is changed. It is usually…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: One of the codons in mRNA that specifies the amino acid phenylalanine is UUC. What is the anticodon…

A: Answer: Introduction: An anticodon means the three-base arrangement, paired with a specific amino…

Q: Why are introns formed if they are going to be degraded? What happens to the chemicals that make up…

A: Introns, from this point of view, have a significant reason. They fill in as problem areas for…

Q: Would a deletion of two base pairs have a greater consequence if it occurred in an intron rather…

A: Would a deletion of two base pairs have a greater consequence if it occurred in an intron rather…

Q: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the…

A: The genetic code is a set of instructions that enable living cells to produce proteins from genetic…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: Which of the following introns have self-splicing activity?a) Group I and group IIb) Group II and…

A: An intron is a nucleotide sequence present within a gene which is removed by RNA splicing before…

Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…

A: The ending of termination and the process involved in it are called transcription termination. The…

Q: A gene affecting the behavioral outlook of individuals was discovered in several humans who can…

A: Transcription is the process of the formation of RNA from DNA. Through transcription, the…

Q: If the wild-type codon is GUU, which of the following single-nucleotide polymorphisms lead to a…

A: Understanding the impact of single-nucleotide polymorphisms (SNPs) on amino acid sequences is…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…

A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…

Q: What is the minimum number of tRNA molecules that a cell must contain in order to translate all 61…

A: A transfer RNA is adaptor molecule composed of RNA having 76 to 90 nucleotides in length.

Q: ic code helps for protein synthesis.

A: Ribosomes are known as minute particles which consist of RNA and  the associated proteins that…

Q: What are Exceptional genetic codes?

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Why do you think the DNA must be unzipped before it is transcribed into messenger RNA?

A: Gene expression is a complex biological mechanism that involves the production of mRNA and proteins…

Q: How do the stop codons UAA, UAG, and UGA know to form? What if a protein stops synthesizing too…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid. The…

Q: What is the result of Frameshift mutations from the insertion or deletion of nucleotides within the…

A: Mutation, an alteration in the genetic material of a cell of a living organism or of a virus that is…

Q: why does translation terminate when the ribosome reaches a stop codon? what happens?

A: Translation is the process by which the genetic information encoded in the mRNA (messenger RNA) is…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: What is the mechanism by which a riboswitch regulates translation?

A: Riboswitches are RNA structures that mainly occur in bacteria, but some are also present in archaea,…

Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…

A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: What is the DNA sequence that encodes the codon AAG, with 5’ and 3’ ends labeled

A: The DNA sequence that encodes the codon AAG with 5' and 3' ends labelled must be TTC from 3' to 5'…

Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC

A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Why does translation need to happen

A: The DNA (deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Why do scientists now believe that AUG is not always the start codon?

A: The start codon is the codon that is translated first for a mRNA transcript. Usually, the most…

Q: Which part of the central dogma is achieved by the process of translation?

A: The central dogma of molecular biology is a foundational system that depicts the flow of hereditary…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: How can you identify the start codon in the mRNA sequence ?

A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…

Q: How many amino acids are coded for by the following mRNA: 5…

A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…

Q: Discuss how the bigger mRNA leads to creation of a smaller polypeptide?

A: For protein synthesis, the first step in transcription. In transcription, the information from DNA…