What occurs during the G1 phase? a. Segregation of chromosomes ( mitosis ) b. DNA replication, synthesis of DNA c. Recovering from mitosis and preparing for DNA synthesis, genes expressed and proteins produced d. DNA rępair and preparing for mitosis dlo iovom ten s

Q: Phenotypes of Offspring Long, Brown Short, Brown Short, Albino Long, Albino a. brown long x brown…

A: Dihybrid cross is a cross between two different lines/genes that differ in two observed traits

Q: -A wild-type strain. -A strain that contains a 15 base-pair deletion in the lac operon operator…

A: The widely used and closely related Escherichia coli "wild types" W3110 and MG1655, as well as…

Q: I am a bit confused on why you switched the correct and incorrect statements. Could you clarify?

A: In genetics there are two types of alleles that are in charge of imparting the phenotypic effects on…

Q: .5 7 6. 4- 2.

A: It comprises three parts, namely, the cell body (soma), axon, and dendrites. The junction where one…

Q: VL Illustrate the given type of epithelium and give at least 2 common locations where it can be…

A: Many cell combined to form tissues . Tissues are divided into :-  A ) Epithelial tissue  B ) Nervous…

Q: Please help me answer this question

A: A compound of hydrogen and carbon, such as any of those which are the chief components of petroleum…

Q: ng 1.3 Check Your Understanding . Study the fish aquarium system at the right. a. List at least six…

A: An aquarium can be described as a closed artificial ecosystem in which fish and plants are able to…

Q: F ST A E BC

A: We know that The hypothalamus and the pituitary gland are part of the neuroendocrine system. The…

Q: 1. What is an unusual feature of the nervous network of cnidarians?

A: Nervous network of cnidarians :-

Q: I am having trouble with these qustions can you help

A: We are answering all parts of first image . For second  image kindly repost.

Q: Which of the following choices is NOT correct? There are three types of cartilages B. Lipids are…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: need information about the Adermatoglyphics condition I have a homework that I need to do and I…

A: Introduction: Dermatoglyphics is the scientific study of the skin ridge patterns on the fingers,…

Q: Can you help me identify the labeled part?

A: Dissection is the method of cutting apart or separating tissue . For example, in the study of life…

Q: Specific prevention. Exists or not. Briefly explain why.

A: A virus is defined as an infectious microorganism made up of a protein-coated segment of nucleic…

Q: Where did you answer the last 2 questions?

A: 5'UTR stands for untranslated region at the 5' end of the DNA sequence. 3' UTR stands for…

Q: are you sure? i got a different answer

A: Skeletal muscles are striped and voluantary muscles. On the other hand, cardiac muscles are the…

Q: What is a usuai Y-incision?

A: Incisions are defined as the surgical cuts that are carefully made on the body of the person in…

Q: Please answer fast

A: Uninary tract infection (UTI) is an infection in any part of your urinary system — your kidneys,…

Q: Can someone help me plz

A: Photosynthesis is the process by which green plants and certain other organisms transform light…

Q: Can you help me identify the white box locations?

A: The cardiovascular system is an organ system which distributes blood to all the parts of the body…

Q: ase Label and name?

A: The respiratory system consists of respiratory organs. The respiratory tract is the passageway via…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: Help me to answer those questions please

A: Tonicity refers to osmotic pressure gradient. It is defined as relative concentration of solutes…

Q: Epistasis Epistasis is when a gene will interfere or hide expression of another gene. In Labrador…

A: Epistasis is the phenomenon of the gene mutation where presence of one of the alleles masked the…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: AUGGUGCCACCGCUGAAGAAGCCUGGACCCUGGCACCCUGUGGACCCUGCAUCCUGGACCCUGGGUGCCACCGCUGAAGAAGCCUGGACCUAGGGUGCCA…

A: The process of protein synthesis involves two major steps - Transcription  Translation  During…

Q: Symptoms/problems for treacher Collins Syndrome

A: Treacher collins syndrome is usually a genetic disease that causes the underdeveloped facial bones.…

Q: im confused, what is the answer?

A: The root system and the shoot system are the two main structures in plants. Every one of these…

Q: G A -J -K AE -F

A: Skeleton is a scaffolding structure of the body which comprises of :-  I ) Bones  II ) Cartilage…

Q: may u break it down a little more please

A: Integumentary system :  Integuments are the largest system of the body. It includes skin and its…

Q: Where does protein digestion begin? A B C

A: Protein is made up of amino acids. Each amino acids are joined each other by peptide bond.