for(int 1e3,y=10; ices ye6; 1+,y2)couteci+v:what is the output of the following code:-O 131313O 1312O 131211none

#include <iostream> using namespace std; int main(){ for(int…

Answered: what is the output of the following…

Engineering

Computer Science

what is the output of the following code:-

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: Thank your for the code!

A: Define a function named create_words_list_dictionary (words_list) which takes a list of words as a…

Q: Functions You have probably noticed that if you try to read into an int variable using scanf but…

A: Find the required code given as below and output:

Q: (PYTHON) A nutritionist who works for a fitness club helps members by evaluating their diets. As…

A: - We yave to help the nutritionist with the code.

Q: Need done in python, thanks. (5 points) This code is supposed to test an int variable ans for…

Q: ▾ Part A - The effect of an arithmetic shift on signed numbers Let's look at see what happens to…

A: signed integer is an integer with a positive "+" sign or a negative "-" sign.checking that the shift…

Q: Write a program that prompts the user to enter the number of hours a car is parked at the airport…

A: Assuming the formula, Parking fee, F is calculated as 5, 0 ≤ h ≤3F = {6 ×int (h+1),…

Q: and max both in Celsius and in Fahrenheit. The formula for converting from Celsius to Fahrenheit is…

A: According to the question, we are going to create a program where the temperature will be shown in…

Q: ( (A + B ) * (C – D) + E / F ) – G Using manual and algorithmic methods, write the following…

A: Given expression: ( (A + B ) * (C – D) + E / F ) – G Convert it into postfix form.

Q: def main(): i = 20 b = mysteriousFunction2 (i) print(b + i) def mysteriousFunction1(i): n=0 while n…

A: For the given code, below is the output.

Q: I need to write the following code taking entera from the user.

A: The answer to thee following question:-

Q: (Yes/No): Is it possible to set the Overflow flag if you add a positive integer to a…

A: Explanation: The Overflow flag denotes the signed integer flow. One can use Overflow flag in the…

Q: What is the output of the following code?

A: The ostream class is represented by the C++ cout expression. It's utilized to generate output for…

Q: (Single Digit) Complete the definition of the following function:singleDigit :: Int -> Int…

A: Find Your Code Below

Q: What is the purpose of the following statement?

A: A purpose statement, also known as a "position statement," is a sentence that outlines a company's…

Q: You will create each program in the IDLE environment and save it as a python file. Use the file…

A: Random number file write and Random number file read:- Write Random Numbers in Files…

Q: (Algebra: solve linear equations) Write a function that solves the following 2 x 2 system of linear…

Q: 5. (Algebra: solve 2 x 2 linear equations) You can use Cramer's rule to solve the following 2 X 2…

A: Step-1: StartStep-2: Declare variables a, b, c, d, e, f, x, y, valueStep-3: Take input from user a,…

Q: (Intro to Python) Write complete python program that defines and calls a function isEvenNumber…

A: PROGRAM CODE: num = int(input("Enter a number: "))if (num % 2) == 0: print("{0} is…

Q: Which of the following statements are equivalent? Which ones are correctly indented?

A: Answer: Explanation: a) if (I>0) if (j>0) x= 0; else if( k>0) y = 0, else z= 0, This code…

Q: I get the following errors for the code above

A: In this question we have to fix and re-write the linked list operations in method using python to…

Q: /* in the worst case scenario: what is the value of count for an input value of 'n'? */ public…

A: Here in this question we have given a code segment and we have asked to find the time complexity of…

Q: AND SHOW COMMENTS TO EXPLAIN CODE A confused Dutchman trying to speak English could say “I am in…

A: the code is an given below

Q: What is the output from each of the following pseudocode statements?

Q: Suppose we want to code the following function below. x2 f(x) = { 21x| – 1 |x|>1 |x| < 1 Write an…

A: Input : Value of x. Output : Value of f(x).

Q: Are the following statements equivalent?

A: No the both the statements are different

Q: (Count the letters in a string) Write a function that counts the number of letters in a string using…

A: CODE:- def countLetters(s) : return len(s)string = input("Enter a string : ");print("number of…

Q: public static void main(String[] args) { int[] a = new int[] {1,2}; swap (a); for (int i =…

A: public class Main{ public static void swap(int [] array){ int temp=array[0];…

Q: Please make sure to match the screenshot below in output) Rolling a single six-sided die…

A: Code :: /* C++ program to roll two dice and show histogram*/…

Q: Which of the following statements are equivalent? Which ones are correctlyindented?

A: In the above statements,all statement contains Two if statement, One else if statement, and One…

Q: (Algebra: solve quadratic equations) The two roots of a quadratic equation ax? + bx + x = 0 can be…

A: Sample Response: //C++ program to find roots of a quadratic…

Q: (In Java) Mathletes Game! With the introduction of loops, we now know enough about programming to…

A: Program implementation for above problem is given below in JAVA language. Further comments are…

Q: 4: Signing a Message generate a signature for the following message (please directly sign this…

A: #include <stdio.h> #include <openssl/bn.h> #define NBITS 256 void printBN(char…

Q: Given the following declaration: nums - { 7 : 12, 4 : 11, 11 : 8 } What is the value of the…

A: In the above question, the dictionary of the number named nums is given. Code : nums =…

Q: Instructions: In the code editor, you are provided with a function that checks whether a number is…

A: In main method, initialise a variable 'n'. Take n as a user input. Initialise an array of the size…

Q: How is the body of a for loop defined? A. The body of a for loop is defined by an indented block of…

A: Repetition statements or looping statements are used to repetitively perform a set of statements as…

Q: def reverse(array): for i in range(0, int(len(array)/2)): other= len(array)-i-1 temp = array[i]…

A: Given code contains reverse() function which takes array as input. Then it contains a for loop which…

Q: Mad Libs are activities that have a person provide various words, which are then used to complete a…

A: The python program is given elow:

Q: Are the following statements correct? Which one is better?

A: Above program image (b) is better because in this program we only use if else statement and we save…

Q: (Python matplotlib or seaborn) CPU Usage We have the hourly average CPU usage for a worker's…

A: Matplotlib For building static, animated, or interactive graphics in Python, consider Matplotlib.…

Q: s='CTCACAGCTTGAACGGCTGTG'; a=regexp (s, '(..) AA', 'tokens', 'once'); disp (a{1}) (A) A (G) AG (M)…

A: We need to find the output of the given Matlab code.

Q: (1) i = N; (2) while (i >= 1) { (3) (4) System.out.print("Enter a number: "); keyboard.nextInt();…

A: Here Line 1 will be executed only once. Then while loop will run from i=N to I=1 i.e it will run N…

Q: What is the output of the following * !program int main(void) { unsigned int a = 13; unsigned int b…

A: a = 13 (1101) b = 1 (0001) c = a & b = 1101 & 0001 = 0001 = 1 c = a <<…

Q: (Replace strings) Write the following function that replaces the occurrence of a substring…

A: Program code: //include the header files#include <iostream>#include <string.h>using…

Concept explainers

Print statement

A statement in a program that displays the variables, object, or text to the output device (screen) is known as a print statement. The print statement consists of a function that forwards the output to standard output devices such as printers, monitors, etc. Depending on the programming language, the syntax of the print statement differs. The print statement allows the user to print the values of multiple variables in a single statement; however, the variables are separated using a separator (comma, plus, etc,).

Question

100%

for(int 1e3,y=10; ices ye6; 1+,y2)
couteci+v:
what is the output of the following code:-
O 131313
O 1312
O 131211
none

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Program

VIEW

Output

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

In C++ please! Nothing fancy needed. I am trying to compare my basic/simple code. Mine is not working. B) Write a program for on p. 65 in the textbook (find the sum of the digits in a positive integer with up to 3 digits). Hint: Use integer division and modulus. Testing: Run the program for the three cases shown below (the first case is the example provided with the problem in the text). • Display the result in the format indicated in the textbook problem. Case 1 Number 999 Any I digit number Any 2 digit number 3 Any 3 digit number (except 999) 2 3
(Converting a Number from Binary to Decimal) The language of a computer, called machine language, is a sequence of 0s and 1s. When you press the key A on the keyboard, 01000001 is stored in the computer. Also, the collating sequence of A in the ASCII character set is 65.In fact, the binary representation of A is 01000001 and the decimal representation of A is 65.The numbering system we use is called the decimal system, or base 10 system.The numbering system that the computer uses is called the binary system, or base 2 system. The purpose of this exercise is to write a function to convert a number from base 2 to base 10.To convert a number from base 2 to base 10, we first find the weight of each bit in the binary number. The weight of each bit in the binary number is assigned from right to left. The weight of the rightmost bit is 0. The weight of the bit immediately to the left of the rightmost bit is 1, the weight of the bit immediately to the left of it is 2, and so on. Consider the…
(Demonstrate cancellation errors) A cancellation error occurs when you are manipulating a very large number with a very small number. The large number may cancel out the smaller number. For example, the result of 100000000.0 + 0.000000001 is equal to 100000000.0. To avoid cancellation errors and obtain more accurate results, carefully select the order of computation. For example, in computing the following series, you will obtain more accurate results by comput- ing from right to left rather than from left to right: 1 1 1 1+ + 3 + ... 2 п Write a program that compares the results of the summation of the preceding series, computing from left to right and from right to left with n = 50000.
can you please type the codeto the following question
-I need someone to help me fix my code. Whenever I input my code and run it, I don't get an error but I also don't get an output. -Here is the guide: Using Python, use import sys to create a program Create a program change.py, that has a function that takes 5 arguments that correspond to the number of $1 dollar bills, quarters, dimes, nickels, andpennies, respectively. Calculate the total value of that change, and print "The total value of your change is $x" where x is equal to the total value. -Here is what I have so far: import sys dollar = int(sys.argv[1])quarters = int(sys.argv[2])dimes = int(sys.argv[3])nickels = int(sys.argv[4])pennies = int(sys.argv[5]) total = dollar*1 + quarters*0.25 + dimes*0.10 + nickels*0.05 + pennies*0.01 print("Total value of your change is $",total) python3 change.py 4 7 8 9 7 -Please provide a revised code
[THIS IS NOT GRADED] The question mentions the bouncy program; this is the bouncy program I have written that computes the total distance traveled by the ball given initial height, bounciness index, and number of bounces: height = float(input("Enter the height from which the ball is dropped: ")) bounciness = float(input("Enter the bounciness index of the ball: ")) distance = 0 bounces = int(input("Enter the number of times the ball is allowed to continue bouncing: ")) for eachPass in range(bounces): distance += height height *= bounciness distance += height print('\nTotal distance traveled is:', distance, 'units.') I will attatch the pre-existing code that the question provided. Thank you for your help.
What is the output of the following code?
I'm getting this error for the above code
Use Type Switches and Asertions sparingly function to write go code. Question is right , please donot reject it Output 70< nil>
Produce the following program.
(Fraction calculator) | Write a program that lets the user perform arithmetic operations on fractions. Fractions are of the form a/b, in which _a_ and _b_ are integers and b ≠ 0. Your program must be menu driven, allowing the user to select the operation (+, –, *, or /) and input the numerator and denominator of each fraction. Furthermore, your program must consist of at least the following functions: Function menu: This function informs the user about the program’s purpose, explains how to enter data, and allows the user to select the operation. Function addFractions: This function takes as input four integers representing the numerators and denominators of two fractions, adds the fractions, and returns the numerator and denominator of the result. (Notice that this function has a total of six parameters.) Function subtractFractions: This function takes as input four integers representing the numerators and denominators of two fractions, subtracts the fractions, and returns the…