What is acetic orcein and what structure does it stain?

On an SDS-gel, If the distance traveled by the bromophenol blue dye is 7 cm, and the distance traveled by the protein band is 2.8 cm, the mobility of the protein is      40     4     40%     0.4

Give detailed Solution with explanation needed needed (please don't copy the answer

How many copies of a protein need to be presentin a cell in order for it to be visible as a band on an SDSgel? Assume that you can load 100 μg of cell extract ontoa gel and that you can detect 10 ng in a single band by sil-ver staining the gel. The concentration of protein in cellsis about 200 mg/mL, and a typical mammalian cell has avolume of about 1000 μm3 and a typical bacterium a vol-ume of about 1 μm3. Given these parameters, calculatethe number of copies of a 120-kd protein that would needto be present in a mammalian cell and in a bacterium inorder to give a detectable band on a gel. You might try anorder-of-magnitude guess before you make the calcula-tions.

Cell biology

Give detailed Solution with explanation (don't give Handwritten answer

You have an aqueous solution containing: Alaine (a mono-amino, monocarboxylic acid) Fructose (a non-ionic monosaccharide) Glycogen (a non-ionic large polysaccharide) Ribose-5-phosphate (an anionic monosaccharide phosphate) t-RNA (a polyanionic nucleic acid, MW~ 30,000). Assuming you have a distinctive assay for each of these compounds, what procedures would you use to obtain gram quantities of each of these compounds free of each of the other compounds

Specific rotation is a measure of a solution's capacity to rotate circularly polarized light. The unfolding of the α helix of a polypeptide to a randomly coiled conformation is accompanied by a large decrease in a property called specific rotation. Polyglutamate, a polypeptide made up of only l-Glu residues, is an α helix at pH 3. When researchers raise the pH to 7, there is a large decrease in the specific rotation of the solution. Similarly, polylysine (l-Lys residues) is an α helix at pH 10, but when researchers lower the pH to 7, the specific rotation also decreases, as shown in the graph. The graph plots pH on the horizontal axis ranging from 0 to 14, labeled in increments of 2, against specific rotation on the vertical axis. The curve for poly (Lys) begins as a horizontal line just above the horizontal axis. This is labeled, random conformation. At 8.5, it bends sharply upward and becomes diagonal at 8.8 until 9.9, when it reaches a height of two-thirds of the height of the…

Dynamic instability is the phenomenon by which microtubules undergo rapid growth and disassembly. Which of the following is true? The GTP cap provides stability to the microtubule Taxol is responsible for the depolarization of protofilaments. GTP hydrolysis is responsible for the continued growth of a protofilament. Beta-tubulin is responsible for ensuring that GTP is not hydrolyzed to GDP.

Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop