What happens during the TERMINATION step of transcription? A. base pairs are added to the mRNA transcript B. RNA polymerase starts creating the mRNA transcript C. RNA polymerase stops adding bases to the mRNA transcript, causing the mRNA to separate from the DNA

Q: What processing step enhances the stability of pretRNAs and pre-rRNAs? a. methylation b. nucleotide…

A: The precursors of transfer Ribonucleic acid (tRNA) and ribosomal Ribonucleic acid (rRNA) are the…

Q: Which dna strand will be synthesized continuously during dna replication? a.The strand that is…

A:

Q: Gene transcription occurs from left to right for gene A and gene B, whereas transcription occurs…

A: Genes are the small portions of the DNA composed of nucleotide bases. These genes are responsible…

Q: Question 1 Which of the following, when mutated, will prevent a messenger RNA from being…

A: Transcription is the process of converting genetic information stored in a DNA molecule into an mRNA…

Q: Which type of mutation involves only one base pair? a. insertion b. deletion c. inversion d.…

A: A mutation occurs when DNA molecules are copied or replicated, resulting in DNA variants that can be…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…

Q: Which of the following characteristics of gene expression is shared by eukaryotic and prokaryotic…

A: Ribosomes are attached to the nuclear membrane when producing secreted proteins. Transcription is…

Q: Briefly describe how transcription works and show that you understand the difference between…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template and DNA…

Q: Which is a feature of mRNA processing in eukaryotes? removal of exon sequences addition of a…

A: Processing of mRNA Until introns are removed and the mRNA is considered ready for translation,…

Q: Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA…

A: Option D is the correct answer

Q: The diagram shows a double-stranded section of DNA. Identify the site of transcription initiation on…

A: Transcription  The process of formation of RNA from DNA with the help of RNA polymerase.

Q: Explain how transcription regulators in eukaryotic cells are able to act at a great distance from…

A: DNA is a nucleic acid present in the nucleus of the eukaryotic cells.

Q: Which statement BEST DESCRIBES the genetic code?   A. There can only be one codon for multiple amino…

A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…

Q: What feature of a DNA fragment causes it to move through a gel during electrophoresis? a. the…

A: Introduction: Gel electrophoresis is a molecular technology that helps to separate the DNA fragments…

Q: What would be the result if an organism’s telomerase were mutated and nonfunctional? a. No DNA…

A: A telomere is a region of repetitive sequences at each end of eukaryotic chromosomes. It is…

Q: Select the most complete list of correct structures involved in the process of transcription…

A: Transcription is a process involved in the expression of a gene that takes place in the nucleus of a…

Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…

A: DNA and RNA are all made up of nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: How does the Trp operon work? A. Binding of Trp to a repressor protein allows the repressor to bind…

A: Trp operon is the cluster of genes that are responsible for synthesis pf operon

Q: What is a reasonable length for an RNA primer in E.coli?   A. 1000 nucleotides     B. 100…

A: In DNA replication one strand of DNA which is lagging require RNA primer to start the synthesis of…

Q: Which gene regulation event is ONLY present in prokaryotes?  a. transcription level of regulation…

A:

Q: How is synthesis terminated in DNA Replication?   a. DNA Polymerase runs out of template   b.…

A: DNA replication is divided into three steps initiation, elongation and termination. In order to…

Q: With regard to transcriptional termination in eukaryotes, which model suggests that RNA polymerase…

A: After RNA polymerase II has transcribed the polyadenylation, which is the process of cleaving the 3’…

Q: What is the central component of a transcription initiation complex?   a.   DNA polymerase…

A: Transcription is the process by which RNA is produced from the DNA template. This process is occurs…

Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…

A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…

Q: Which statement is true about RNA polymerase (which is required for transcription)? A. RNA…

A: Transcription  It is the process through which the sequences in strand of DNA forms into the…

Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…

A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…

Q: 5’GCTATAAAGCGTATCGCGTCATA 3

A: Complementary mRNA      5’GCT ATA AAG CGT ATC GCG TCA TA '3     3'CGA UAU UUC GCA UAG CGC AGU AU '5

Q: What are the three phases of creating pre-mRNA? a. Initiation, Elongation and Termination b.…

A: Pre-mRNA, also known as precursor messenger RNA, is the first RNA molecule transcribed from a DNA…

Q: Why are mutations more likely to occur in repeated DNA sequences? a. These bases are unstable b.…

A: Repetitive DNA sequence Repetitive DNA refers to the stretches of DNA that repeat throughout the…

Q: What is the name of the process that adds a modified guanosine nucleotide to the 5’ phosphates of…

A: In eukaryotic cells,pre-mRNAs go through three main steps: Capping at 5' end Addition of poly A…

Q: When can a mutation on the DNA cause production of a longer translation product?  Give a specific…

A: Mutation is a process by which alternation of DNA sequence take place which unltimately results in…

Q: DNA polymerases have a shape resembling a right hand with three domains. Explain how these three…

A: DNA polymerase enzyme comprises multiple subunits that play a unique part during DNA synthesis. It…

Q: Synthesize mRNA strands from the DNA templates

A: The DNA consists of two strand template strand and complementary strand. The molecule of DNA…

Q: In prokaryotes, rho-independent transcription termination depends on a secondary structure formed…

A: Transcription is a fundamental process in that involves the synthesis of RNA molecules from a DNA…

Q: D. Which letter in the diagram above best corresponds to the location where exons are found? O A O C…

A: The method of producing RNA copies of a genetic sequence is known as transcription. This duplicate,…

Q: A scientist is interested in producing flowers with a darker red color. To do this, the scientist…

A: Si RNA is a small interfering or silencing RNA, which is a non-coding, double stranded RNA molecule.…

Q: In RNA silencing, siRNAs and miRNAs usually bind to which part of the mRNA molecules that they…

A: Small interfering RNAs or siRNAs and micro RNAs or miRNAs are those RNA segments that don't code for…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.