uiguniJm3 Can be paSseu Un tU tieir ofnspring. 13. Darwin explained the differences in beak shape among Galapagos finches as being the result of a. chance events b. adaptations to eating different foods. c. differences that existed in the colonizing species d. inheritance of acquired characteristics ducation TM, Inc.

Q: Define renin

A: Renin was first discovered by Tigerstedt and Bergman in 1898 in the saline extracts of rabbit…

Q: Adenine always pairs with

A:

Q: identify the question being asked   IUPAC name for C16:0

A: The IUPAC nomenclature of organic chemistry is a technique of naming organic chemical compounds that…

Q: Which of the following bonds (labeled by arrows A-H) will be cleaved by trypsin?   Group of answer…

A: Trypsin is a member of serine protease family. Serine protease are a class of proteolytic enzymes…

Q: Which of the following have the complete information about the fatty acid? он

A:

Q: hidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'

A: The structure and function of the entire body are controlled by DNA. It is present in every cell. It…

Q: If N<k, the value of r is negative and the population declines. Natural populations may grow at…

A: The equation for logistic growth is: dN/dt = rN (K-N)/K When N&lt;&lt;&lt;&lt;K Which means…

Q: Identify the highlighted structure

A: Cells are the structural and functional unit of life. Many cells combine to form tissues and many…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: Why Ranitidine is better than Cemitidine? Please explain at your own words.

A: There are several drugs used to treat peptic ulcer disease. Peptic ulcer is characterized by…

Q: A B C (b) [Choose ] [Choose] [Choose ] <

A: The peripheral nervous system of the body consists of several nerves and ganglia, which play an…

Q: Stiffening of the arteries, joints, and lensesin old age may be a result of cross-linkingbetween…

A: Collagen is the most important structural protein in the extracellular matrix, and is present in all…

Q: what are centrioles?

A: Centrioles are found in most of the eukaryotic  cells.  Centrioles are surrounded by pericentriolar…

Q: 11 Endocrine glands are often called "ductless glands" because their products are secreted directly…

A: Endocrine glands secrete hormones. Hormones are secreted from one gland and activates the functions…

Q: Why does hematoxylin stain cartilage?

A: Hematoxylin is the principle tissue stains used in histology. It is a complex of aluminium salt and…

Q: What is centriole ?

A: Centrioles are paired barrel-shaped organelles located in the cytoplasm of the animal cells near the…

Q: 28. How do medical asepsis and surgical asepsis differ?

A: Medical refers to the field of knowledge, practice, and study related to the diagnosis, treatment,…

Q: Describe lysine degradation.

A: The amino acid is an organic acid that contains an alpha carboxyl group, alpha amino group, a…

Q: 1. What is the possible identity of the amino acid? [ Select] V 2. What is the isoelectric point of…

A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…

Q: IDENTIFY THE FOLLOWING PARTS  A  B  C  D  E  F  G  H  I  J

A: The cell is the basic and functional unit of life. It is composed of various cell organelles.

Q: protein folding briefly

A: Protein is a polymer of amino acids connected together via peptide bond. In a cell, proteins are…

Q: Amino acid +Amino acid >Dipeptide +______

A: Proteins are macromolecules composed of monomeric units called amino acids. These amino acids are…

Q: Give the complete name of the peptide below.

A: A peptide is a molecule that contains two or more amino acids linked together via peptide bonds. A…

Q: Identify the amino acid shown below. (Note: single letter code is provided as answer) H. H,N-C-COOH…

A: Amino acids are chemical molecules that combine to produce proteins and are hence known as building…

Q: labelled X

A: The element that is present in 'X' part is "Adenine".

Q: 510. Trypsin cleaves proteins after lysine and arginine residues. Trypsin itself has 13 lysine and 2…

A: By cleaving peptide bonds in the protein sequence, protease catalyzes the hydrolysis of proteins…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: what is lab value of creatinine

A: Creatinine is the breakdown product of creatine phosphate from muscle and protein metabolism .Serum…

Q: Which structure is highlighted?

A: According to our guideline we can answer only the first question. So, upload the second image…

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingosine is composed of  an amino alcohol head group, with two hydroxyls, and one amino group…

Q: Why is cholesterol an important steroid?

A: We can say that Cholesterol is a fatty substance that is synthesized by the liver and is circulated…

Q: 15 Explain why detergents, which have an amphipathic structure like bile salts, are able to remove…

A: Detergent- These are the powder that contains chemical properties and are used for the removal of…

Q: CH, H H ОГТІ 0= II Т Н H-C- H₂C-N-C-C-O-P-OC-H CH, H H О 1 H-C-0 -Т Н 2 онннн Н II ТТГ Н Н Н Н Н Н Н…

A: A molecule is the smallest part of any substance that is made up of different atoms connected…

Q: 8 sources of monosaccharaides

A: Ans: Monosaccharaides: The simple form of sugars which only has one oxygen as well as two hydrogen…

Q: what is a a lysate.?

A:

Q: hertability refers to

A: Genetics is the branch of Biology dealing with the study of genes including their structure,…

Q: Based on the F-actin assembly data presented above, which type of actin-binding protein is Protein…

A: F- actin is a crucial protein for cellular  function and responsible for cell stability. Actin…