Then propose one ecological study and one cohort study on whether vape pens are associated with smoking cessation. Be sure to be clear about the population you would include and how you would define the exposure and outcome. Which of these two studies would provide the strongest causal evidence, and why?
Q: Question 14 During RNA chain elongation gyrase proceeds ahead of the transcription bubble in order…
A:
Q: The best example of a covalent R- group interaction in protein is ] A Asp-Lys b Ser-Gin c A=U…
A: ANSWER)(e) S-S in Cys - Cys Cystine interaction is the best example of covalent R-group interaction…
Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: When there is an error in the DNA sequence during replication it causes a change in the DNA…
Q: Shown below are photomicrographs of Rhoeo tradescantia cells undergoing meiosis. Answer the…
A: Introduction Mitosis is the division of replicated chromosomes into two new nuclei during the cell…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: List 3 species of bacteria that can spoil milk and indicate how they react to the gram staining…
A: Spoilage of milk and milk products results from growth of fermentative bacteria when storage…
Q: Which option is a nonrenewable source of energy Petroleum Sunlight Water Wind
A: We used energy from our environment to do verious work. For light, heat, current, industry we used…
Q: A carton of milk, under the right conditions, will undergo ___ type of succession.
A: Introduction Succession:- It is the change in either species composition, structure, or architecture…
Q: Match the description with the type of evidence of evolution they belong to. 1. Homologous…
A: Evolution is the change over time. It is the unifying theory of biological science. There are many…
Q: In the 33 hr. chick embryo stage what structure/s would serve as a guide to approximately…
A: Auditory vesicles are distinct. Three pairs of arterial arches arise from the ventral aorta. Somites…
Q: The students of a Microbiology class were tasked to transfer or subculture a pure culture of…
A:
Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…
A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…
Q: populations of flightless grasshoppers (Population A and B) are separated by a river that contains…
A: This is a type of natural selection occurring here. Natural selection was a concept given first by…
Q: Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the…
A: Primase is an RNA polymerase that requires ssDNA to make RNA primers during DNA replication.
Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?
A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…
Q: Which of the following represents an accurate pathway of energy transfer through trophic levels of…
A: Energy transfer In the trophic levels the energy transfers from the producers to the consumers. In a…
Q: Can (1) chain and (2) ring structural abberations still lead to fertile gametes? explain
A: Abberations indicates the genetic material which should be DNA . The DNA transfer the information…
Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…
A: Introduction Muscles are a type of soft tissue. muscles are made up of a lot of flexible fibres.
Q: He then ran the sample on an agarose gel and observed a strong band at approximately 400bp. What…
A: The band represent a small piece of DNA that was cut with restriction endonuclease and then…
Q: a gene insert itself into a bacterium’s Genome often distracting part of the genome. This is an…
A: Several types of techniques are incorporated in the molecular biology to get more desirable results…
Q: How can thinking of Earth as an island help us in the quest for a sustainable future?
A: Answer :- As we know that The earth is like an island. It is a shut framework with repsect to issue.…
Q: Discuss the societal impacts of the use of transgenic Golden Rice. What are some potential benefits…
A: INTRODUCTION A genetically modified organism is a living organism whose DNA has been altered via the…
Q: Post-transcriptional modifications in eukaryotic RNAS A. addition of CCA at the 5'end of the TRNA…
A: Post transcriptional modification is a process in eukaryotic cells by which newly synthesis RNA…
Q: Given the scenario, compute for the total volume of the culture media solution (milliliter or liter)…
A: We have been given the concentration of the nutrient broth and Agar and we have also been given the…
Q: Central self-tolerance in the immune system arises when maturing T cells in the thymus undergo…
A: Apoptosis is a process of natural cell death. T cells are matured in Thymus but are born in Bone…
Q: What is dna?
A: Answer
Q: Give the number of cleavage of uvarovite, grosullar, and andradite?
A: Garnet is a mineral group made composed of many closely related minerals. Garnet minerals share…
Q: Viruses with reverse transcriptase enzyme can make a DNA copy out of its RNA genome. What…
A: Reverse transcriptase (RT) It is an enzyme through a single-stranded RNA transcribes into the DNA.…
Q: Complex III delivers 4 protons. Where do these 4 come from UQH2 mitochondrial intermembrane space…
A: Introduction :- The electron transport chain's Complex III, also known as Q-cytochrome c…
Q: Certain cells in the retina respond differently to the direction in which objects move. To…
A: A retinal ganglion cell (RGC) :- is a kind of neuron which is found near the inner surface of the…
Q: Which of the following is not true regarding DOGEMs sequencing? it could result in more than one…
A: Answer :- Option (A) is correct. - It could result in more than one complete phage genome sequence.
Q: Give economic and ecological significance of Rice (Oryza)
A: Rice (Oryza sativa) is a grain and food. It is swamp grass by nature. It is a staple meal in many…
Q: True or False: 1. All functional transcripts have been initiated, elongated and terminated with…
A: False : post transcription events include splicing, capping, tailing. Initiation is the beginning of…
Q: Which statement is true about RNA polymerase (which is required for transcription)? A. RNA…
A: Transcription It is the process through which the sequences in strand of DNA forms into the…
Q: With a diagram trace the movement of electron during the LRP of photosynthesis.
A: Photosynthesis is a process in which carbon dioxide and water is used up as raw material along with…
Q: one: A 45 years old male who is a participant in a new medicine trial that blocks the renal tubule…
A: Urine is mainly formed in the nephrons of the kidney. Nephron is the smallest unit of excretion.…
Q: Describe the process of DNA replication of the leading strand?
A: DNA replication It is the process by which DNA make exact copy of itself. The replication of DNA is…
Q: Crossing over gives genetic and happens during the stage of meiosis I.
A: Cell division happens when a parent cell divides into two or more daughter cells. There are two…
Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…
A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…
Q: Chemiosmosis
A:
Q: Which theory of aging states that unstable oxygen molecules tend to steal electrons as they bounce…
A: The unstable oxygen molecules have higher energy and can damage the biomolecules.
Q: 1. The physical factor influencing water entry into and exit from cell interior resulting in…
A: Introduction A pathogenic bacterium, or microbial cell, is a living entity that is too small to see…
Q: Which of the following true of active immunity? Is considered to provide short term protection O…
A: Ans: Active immunity results when the exposure to disease organism stimulate the immune system to…
Q: True or False: 1. There is the bidirectional mode of replication during S-phase. 2. Single strand…
A: The replication is the process of new DNA synthesis from the old DNA template by semiconservative…
Q: Write down the levels of ecosystem organization from smallest to largest, next to its' description.…
A: We will answer the first question as the single question is not specified. Please specify the…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: Which of the following signs is most often observed in acute and chronic alcoholism? OA. Barret…
A: Alcohol poisoning is a condition caused by the rapid and excessive consumption of alcoholic…
Q: ALL ANSWERS MUST RELATE TO THE NATION CHILE 4- Biosphere / Environmental Sustainability Challenges:…
A: Ans: Chile is a Latin American country and comes under the 35 world's biodiversity hotspots due to…
Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…
A: This question is about gene.
Q: Leo, 37-years old was absolutely shocked when he found out that he has a hypertension. He was once…
A: Kidney are the chief organ of Urinary system in which formation of urine takes place via nephrons as…
Step by step
Solved in 4 steps
- The following characteristics describe a cross-sectional study: A. The outcome is at the individual-level B. The exposure is at the group-level C. The outcome is at the neighborhood level D. People are recruited into the study based on disease status or having a condition. E.This study design is particularly susceptible to the ecologic fallacyThe following data is from a prospective cohort study examining the association between air pollution exposure and lung cancer. Calculate the Attributable Risk Percent. Lung Cancer Cases No Lung Cancer Exposed to Air 550 600 1150 Pollution Unexposed to Air 150 700 850 Pollution Total 700 1300 2000 O 63.1% O 302 per 1,000 30.2% O 2.7In a cohort study, the ratio of the incidence rate of a disease in an exposed group to the incidence rate of the disease in a nonexposed group is the: a. Relative risk b. Risk difference c. Prevalence ratio d. Odds ratio
- Visit the website of the National Center for Health Statistics. Spend some time studying the leading causes of death for different age groups at www.cdc. gov/nchs/data/nvsr/nvsr56/nvsr56_05.pdf. What are the three leading causes of death for each age cohort listed? What are some of the policy implications?Ecologic fallacy refers to.... A. Ascribing the characteristics of a group to every individual in that group. B. Assessing exposure in large groups rather than in small groups. C. Examining correlations of exposure and outcomes rather than time trends. D. Assessing outcome in large groups rather than in many small groups. E. Failure to examine temporal relationships between exoosures and cuscoreWhich of the following is not true of cohort studies? a. Risk can be observed directly in a cohort study b. Cohort studies are good for studying the impact of rare exposures in the population c. The exposure is well defined in cohort studies d. Cohort studies carry the highest risk of misclassification of exposures (that is, incorrect identification of participants as exposed or unexposed)
- Should population health management focus on populations with the greatest disparities and health inequity or areas where the greatest financial opportunities are present? why.Explain comprehensively the Bottleneck Effect and Founder’s Effect. Illustrate using specific exampleStudies of populations in which observation is accompanied by experimental manipulation of some population members is referred to as:
- If the one- year cumulative incidence for exposed subjects is identical to that of non-exposed subjects then: a. one - years incidence rates must be identical for exposed and non- exposed subjects; b. survival curves must be identical for exposed and non- exposed subjects; c. median time to event must be identical for exposed and non- exposed subjects; d. none of the aboveCross-sectional surveys measure:A. The prevalence of various demographic characteristics in a well-defined populationB. The exposure histories of a well-defined populationC. The disease states in a well-defined populationD. All the aboveMatch the outcomes to whether they are obtained from manipulative experiments or observational studies: 1 2 2 Inference of causality Tests for patterns and possible processes under natural conditions Tests of causes that are difficult to control 1. Manipulative experiments 2. Observational studies