The following program is to print a rectangle of character. The height and length is based on user's input. Fill in the blanks (7) to complete the C program #include_(a)_ void printTriangle(int, char)://function prototype int main0 { int input: char symbol: printf("Please enter a number : "); scanf_s ("%d", &input): while ((getchar() != '\n'); //clearing input buffer printf("Please enter a character symbol : "); scanf_s (b)_); printTriangle(_(c)): } void printTriangle(int size,(d)_D{//function header int i, j: for L(e) for (j = 0:_(fj++) printf("%c ", sign); (g):

The following program is to print a rectangle of character. The height and length is based on user's input. Fill in the blanks (7) to complete the C program #include_(a)_ void printTriangle(int, char)://function prototype int main0 { int input: char symbol: printf("Please enter a number : "); scanf_s ("%d", &input): while ((getchar() != '\n'); //clearing input buffer printf("Please enter a character symbol : "); scanf_s (b)_); printTriangle(_(c)): } void printTriangle(int size,(d)_D{//function header int i, j: for L(e) for (j = 0:_(fj++) printf("%c ", sign); (g):

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Similar questions

28.
Question 1 Write a C++ program that defines an integer array of size 18, the program asks the user to fill the array from the keyboard. After filling the array, the function prints all values that are divisible by 3 and less than the average Use the editor to format your answer
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Refer to the statement below, #include void main() { int i; int number[11]={12,15,17,3,2,7,10,10,15,15,50}; for(i=0;i < 11; į++){ printf(" %d", number[i]); } Write a segment in C language to: Compute the average number Find the maхітит аnd minimum питber
C++ LANGUAGE (FUNCTION)
PART I: Functions – Math Test Write the Flowchart and Python code for the following programming problem based on the pseudocode below. Write a program that will allow a student to enter their name and then ask them to solve 10 mathematical equations. The program should display two random numbers that are to be added, such as: 247 + 129 The program should allow the student to enter the answer. The program should then display whether the answer was right or wrong, and accumulate the correct values. After the 10 questions are asked, calculate the average correct. Then display the student name, the number correct, and the average correct in both decimal and percentage format. In addition to any system functions you may use, you might consider the following functions: A function that allows the student to enter their name. A function that gets two random numbers, anywhere from 1 to 500. A function that displays the equation and asks the user to enter their answer. A function that…
vi) In C++, rotate the array given below to left by 2 places and print it in the output. int A[6] = {12, 34, 56, 78, 2, 21}; Expected Output: {56, 78, 2, 21, 12, 34}
practice python part 3
function+array add function for the code below to find the sum of secondary elements the sum of element above main diagonal the sum of element below main diagonal the average of all elements in c++ for beginners please // Example program #include #include #include #include using namespace std; //recursive functions const int size=10; void fill(int x[size][size]) { for (int i=0;i