QUESTION 8The following algorithm construct a sequence of positive whole numbers, which demonstrates the famous Collatz's conjecture: starting from anypositive whole number, the sequence will eventually go down to 1.1. input: positive integer x2. i+03. repeat3.1. i+i+13.2. if x is odd then3.2.1. x (3 x x) + 1else3.2.2. x x+ 2until x = 14. output iBy tracing the algorithm, how many times does the algorithm perform Step 3.2.1. if the input is set to x = 6?

Collatz's Conjecture: The Collatz conjecture affirms that the absolute halting season of each n is…

The following algorithm construct a sequence of positive whole numbers, which demonstrates the famous Collatz's conjecture: starting from any positive whole number, the sequence will eventually go down to 1.

The following algorithm construct a sequence of positive whole numbers, which demonstrates the famous Collatz's conjecture: starting from any positive whole number, the sequence will eventually go down to 1.

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter8: Arrays And Strings

Section: Chapter Questions

Problem 22PE

See similar textbooks

Similar questions

Basic Computer Programming ActivityLanguage: CShow the code and how it works thanks
Credit card numbers follow certain patterns: It must have between 13 and 16 digits, and the number must start with:■ 4 for Visa cards■ 5 for MasterCard credit cards■ 37 for American Express cards■ 6 for Discover cards In 1954, Hans Luhn of IBM proposed an algorithm for validating credit card numbers. The algorithm is useful to determine whether a card number is entered correctly or whether a credit card is scanned correctly by a scanner. Credit card numbers are generated following this validity check, commonly known as the Luhn check or the Mod 10 check, which can be described as follows (for illustration, consider the card number 4388576018402626): 1. Double every second digit from right to left. If doubling of a digit results in a two-digit number, add up the two digits to get a single-digit number. 2. Now add all single-digit numbers from Step 1. 3. Add all digits in the odd places from right to left in the card number. 4. Sum the results from Steps 2 and 3. 5. If the result from…
1. Design an algorithm to find the weighted sum of four test scores (https://en.wikipedia.org/wiki/Weight_function). Assume that the weights have been accurately calculated in advance such that their sum equals one. Your algorithm must-read in the four test scores and four corresponding weights in the following order: score1 weight1 score2 weight2 score3 weight3 score4 weight4 Write your algorithm such that it can be run with any set of data values. However, you can test your algorithm on the following sample data to verify that the result is 70: 90 0.10 80 0.20 70 0.30 60 0.40 2. Write an algorithm that prompts the user for the radius, in inches, and price of a pizza, and then reads in those values. Finally, have the algorithm compute and output the pizza’s cost per square inch. 3. Sports exercise advisor algorithm. In this algorithm you will start out with a temperature value in Celsius, so you do not need to ask the user for it. First, convert the temperature to Fahrenheit.…
Fibonacci series is that when you add the previous two numbers the next number is formed. You have to start from 0 and 1. E.g. 0+1=1 → 1+1=2→ 1+2=3 →2+3=5 → 3+5=8 → 5+8=13 So the series becomes 0 11 2 3 5 8 13 21 34 55 Steps: You have to take an input number that shows how many terms to be displayed. Then use loops for displaying the Fibonacci series up to that term e.g. input no is =6 the output should be 0112 3 5
Homework 5 CMP 167: Programming Methods I Lehman College, City University of New York Homework 5-1 I Write a program with a loop that iterates as long as an int variable called num is less or equal to 50. Num must be initialized with a value of 1 and incremented by 1 with each iteration. Each iteration of the loop must print all appropriate sentences for that number according to the following 1. If num is odd, output: num is an odd number 2. If num is even, output: num is an even number output: num is divisible by 2 3. If num is divisible by 2, 4. If num is divisible by 5, output: num is divisible by 5 5. If num is divisible by 8, output: num is divisible by 8 6. If num is divisible by 11, output: num is divisible by 11 Please note that your class should be named FirstLoop.
Java - Mad Libs Loops
python3 problem
Java Program A Number is said to be a PRIME number if it only have 2 factors which is 1 and itself. The number 1 is neither a PRIME or COMPOSITE number. Input: 3 Output: Input Number: 3I am Optimus Prime
PYTHON CODING
Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT
Java Programming
Description A mathmatician Goldbach's conjecture: any even number(larger than 2) can divide into two prime number’s sum.But some even numbers can divide into many pairs of two prime numbers’ sum. Example:10 =3+7, 10=5+5, 10 can divide into two pairs of two prime number. Input Input consist a positive even number n(4<=n<=32766). Output Print the value of how many pairs are this even number can be divided into. Sample Input 1 1234 Sample Output 1 25