The exact output produced after executing the following C++ code isintr = 10;void check(int &a, float b){static float k = 5.0;k += a + b;b--;r= a * 2;cout<< k <<" HI "<< r<<" NEXT ";}a--;int main(){inth = 4;float g=9.0;cout << fixed << showpoint << setprecision(2);check(h, g);check(h, g+2);return 0;}

The program is written in C++. Please find the source code and output in the following steps.

Answered: The exact output produced after…

The exact output produced after executing the following C++ code is intr = 10; void check(int &a, float b) { static float k = 5.0; k+= a + b; a--; b-; r= a* 2; cout<< k <<" HI "<

Database System Concepts

7th Edition

ISBN:9780078022159

Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Publisher:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan

Chapter1: Introduction

Section: Chapter Questions

Problem 1PE

See similar textbooks

Related questions

Q: C++ EDP 101- COMPUTER PROGRAMMING AND FUNDAMENTALS Write a c++ program that convert a decimal number…

Q: Question#3 Perfect numbers are numbers that equal the sum of their positive divisors except itself.…

A: Given :- write a program in C to check whether a given number is a perfect number or not. A perfect…

Q: Assume a function F1 is defined with the heading: int F1(int a, double &b, double t[]); Assume…

A: function heading int F1(int a, double &b, double t[]); and variables defined are : int a1:…

Q: + Program correctly please experts. I have given all the inf

A: Solve the following C++ Program correctly please experts. I have given all the information below…

Q: Find the error(s) in the following code segments and fix them: if ( temperature = 100 ) cout <<…

A: Solution :

Q: Figure 1 shows a complete C codes with erors. By refeming to Figure 2 below, please explain 10 erors…

A: #include <stdio.h>// error 1 : we do not use = sign in #define// #define A=5#define A 5#define…

Q: Allowed languages с Problem Statement Write a C Program that will compute for npr (n taken r…

A: Write a C Program that will compute for nPr (n taken r permutations). Input Input starts with a…

Q: Write a C++ program that takes as input an arbitrary number of red blood cell counts in the range 0…

A: #include <iostream>using namespace std; int main() { int i, count ; float…

Q: C++ program what are the output for each of the following :

Q: Do not use array or advance logic simple c++ Write and test the “digit” function: Function…

A: A group of statements that executes only when it is called is known as a Function. A function can…

Q: Problem Statement Write a C Program that will compute for the GCD of M numbers

A: Introduction: In this question, we are asked to write a program to find the gcd for m numbers in…

Q: Answer in C++ Only: Mother is the most loved person. She wants to surprise his son on his birthday…

A: Start.Read an integer input from the user and assign it to the variable "input."Execute a loop…

Q: Question: As an engineer and a software developer your job in this project is to declare and…

A: Solution: 1. Implementation of Printmat() function: // Printmat() methodvoid Printmat(float…

Q: C Programming practice gn Write a C program that takes a command line argument of a number that you…

A: I have provided solution in step2.

Q: C Programming practice gn Write a C program that takes a command line argument of a number that you…

A: Ans -- #include<stdio.h> #include<string.h> int factorial(int num) { if(num == 0)…

Q: void main(void) { int n; int ans; // the input value // the answer int temp; // a temporary value //…

A: The given C code snippet appears to be a segment from a program running on some microcontroller,…

Q: Answer in C++ Only: Mother is the most loved person. She wants to surprise his son on his birthday…

A: See the below C++ code

Q: Assume that users A and B have spreading codes 01010101 and 01011010, respectively. Denote bit 0 as…

A: To determine the signal content generated when both users A and B transmit data bit 1, we need to…

Q: Write a C Program that determine whether a number is a prime number or not. Input Input starts with…

A: 1) Below is C program that determines a number is prime or not. In main function of program, it…

Q: C code Blocks Write a function that accepts three floating point numbers and returns the average of…

A: To Do: Write a C program.

Q: Note: soution this program without use Struct 1. Write a program to do the following:

A: The program contains two functions: CoverPage() with no return type to print HW details. Kindly…

Q: The quadratic formula is used to solve a very specific type of equation, called a quadratic…

A: PROGRAM EXPLANATION: - The Disc.py contains the discriminant function having three parameters for…

Q: C Programming Please: #include #include int main() Write a program to model a simple…

A: see the code in c programming language

Q: In C++ Suppose we add a fixed amount of money into our bank account at the beginning of every year.…

A: Here is the c++ code of the above problem. See below steps for code.

Q: ✓ Allowed languages C Problem Statement Write a C Program that will determine the largest digit in a…

A: First, we will input the value of N. Then we will take the "num" as input. Using nested while loop,…

Q: C++Write a program to define a function that is used to return the volume and surface area of a cube…

A: C++ is one of the most popular programming languages developed by Stroustrup at Bell Labs. The basic…

Q: Employee Salary Calculator Program and Analysis Demonstrate an understanding of C++ programming…

A: Start. Declare three variables of double type, namely, standardHours, rateOfPay, and overtimeHours.…

Q: Task - Using pointers to process arrays (C Language) Example #5 below expected output is 45, but…

A: Introduction The given question is asking for a program that calculates the maximum number of…

Q: Answer in C++ Only: Mother is the most loved person. She wants to surprise his son on his birthday…

A: Step-1: StartStep-2: Declare the necessary header files: 'iostream', 'vector', 'algorithm', and…

Q: Python Language Special Rules: For this task, use only Boolean/math expressions and conditional…

A: Coded using Python 3.

Q: Consider the following C++ codes: Code a: Code b: int x-8; // global void func () int x-8; // global…

A: Let us see the details below,

Q: Survey Data Analysis Computers are commonly used to compile and analyze the results of surveys and…

A: As per the requirements, the below program made using C language will input the 30 responses and…

Q: Lab Assignment Question 3-Program in C++ to take input size of array from user and then take input…

A: Take input size and values of array from user. After that initialise a variable sum=0. Run a loop…

Q: ased on the following C code: { int x, y, z, sum, total; int *pt1, *pt2, *ptc;…

A: 1{ 2 int x, y, z, sum, total; 3 int *pt1, *pt2, *ptc; 4 5 x = 99; 6 y = 86; 7 8 pt1 =…

Q: In a void function, how would you utilise a return statement?

A: Introduction: In a void function, how would you utilise a return statement?

Question

The exact output produced after executing the following C++ code is
intr = 10;
void check(int &a, float b)
{
static float k = 5.0;
k += a + b;
b--;
r= a * 2;
cout<< k <<" HI "<< r<<" NEXT ";
}
a--;
int main()
{
inth = 4;
float g=9.0;
cout << fixed << showpoint << setprecision(2);
check(h, g);
check(h, g+2);
return 0;
}

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.

Similar questions

computer programing (C++) i need to get an algorithm ( flowchart and pseudocode) #include<iostream> //header file using namespace std; float function1(float, float[]); //function prototype for function1 float function2(float, float[]); //function prototype for function2 float function3(float[], float[]); //function prototype for function3 int function4( ); int main( ) //main function { float vin, R[4], i[4], v[4]; //declare float variables which are R,i and v int choice; //declare int variables for choice cout<<"Enter vin: \n"; //ask user for enter vin cin>>vin; //read the input cout<<"Enter R1, R2, R3: \n"; //ask the user enter value R1,R2, and R3 cin>>R[1]>>R[2]>>R[3]; //read input cout<<"Select from the menu: \n"; //ask user to select the menu…
Describe the process of converting a logical formula into DNF. What are the steps involved?
C Programming "Functions"
C PROGRAM Create a c program that will convert number figures into words 1. You can use user-defined functions, string, array, and loops 2. Maximum input limit is 10000.00 Sample output (bold letters is for input) Enter amount in Peso: 143.50 You just entered P145.50 equivalent to One Hundred Forty Three and Fifty Centavos. Do you want to convert another amount? [Y|N]: N
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
C++ program
C++ code not Java
JAVA CODE PLEASE Recursive Functions Practice ll by CodeChum Admin Create a recursive function named factorial that accepts an integer input as a parameter. This calculates the factorial of that integer through recursion and return it. In the main function, call the factorial function and assign the value to a variable. Print the value in the next line. Input 1. One line containing an integer Output Enter·a·number:·4 24
answer needed soon it's c programming
C programming
Topic: Recursive Function A bank increases the interest rate it gives to its customers by 1% every month the money stays in the bank. Write the recursive function that calculates the total amount of money at the end of the maturity date, based on the condition below. The parameters of the function: capital, initial interest rate and maturity date(months) Note: Codes should be written in C programming language.
C++ Language