solve the following questions? 1) 2x/3+1<6x/4 2) If x is the length of one side of a square, then what is the values of x in feet for which the perimeter of the square is more than 100 feet?
Q: 3) The initial sate : A {A,B} {C} {D} The final state : {D} {A} {C} A В Ø
A: a) the initial stage A, The final stage D 0 1 A {A, B} {A} B {C} {C} C {D} ∅ D {D} {D}…
Q: 6) What are the values of these sums, where S = {8, 10, 14, 20, 21, 24, 29}? %3D 2 a ) Σκes k b)…
A: 6) Given, S = { 8, 10, 14, 20, 21, 24, 29 } a) Σ k ∈ S k = 8 + 10 + 14 + 20 + 21 + 24 + 29 =…
Q: hexadecimal We usually write numbers in decimal form (or base 10), meaning numbers are composed…
A: Hexadecimal is a numbering system with base 16 used to represent large numbers with limited digits.…
Q: Python code Write a function that, given two integers, return the product of every integer between…
A: As per our guidelines we are suppose to answer only first question. Kindly repost other question…
Q: Return True if and are both True, ONLY Using 'not' and 'or'. This means you CANNOT use operators…
A: Create a function my_and(a, b) that return True if both a and b are True else return False only…
Q: You are planning an outing with some friends and need to calculate the total price of the tickets. A…
A: Given data, Write a program in a file named tickets.py Some of the friends planning an outing and…
Q: 1. Let A and B two matrices, write a Python3 function to calculate the subtraction of these two…
A: Find Your Code Below
Q: Use c++: Enter n numbers stop with sentinel (-1) and show how many and which are odd and even:…
A: Step-1: StartStep-2: Declare varaible n,arr_even[100],arr_odd[1000]Step-3: Declare varaible even and…
Q: short answers : c)Give an example of a common floating point arithmetic error due to the particular…
A: an example of a common floating-point arithmetic error due to the particular way in which…
Q: % WRITE CODE BELOW: % Step 1: Write a function called "collatz" below where you take an input % n,…
A: Here is the matlab code of the problem. See below steps for code and output.
Q: Read the following passage below. Then describe the 3 important ways spreadsheets can help you or a…
A: Given:-
Q: Python programming only (PLEASE INCLUDE INPUT VALIDATION IF NEEDED) a province gathers local…
A: Start.Create a function calculate_property_tax that takes the actual property value as…
Q: Organizers of the Army Land programs, people have already started preparing for the upcoming sports…
A: Algorithm The first line of the input contains a single integer T. T denoting the number of test…
Q: Q5: Write relational expressions to express the following conditions (using variable names of your…
A: As per our guidelines we are supposed to answer only one question. Kindly repost the remaining…
Q: You will use sequential, selection and repetition programming statements. You will define one…
A: Here we have given appropriate code in python. You can find the solution in step 2.
Q: 1a) Give the values of the following: M[i,i+1] for i=1,...,5 M[i,i+2] for i=1,...,4 M[i,i+3] for…
A: Given six matrices A1, A2, A3, A4, A5 and A6 for which we wish to compute the product A = A1 A2 A3…
Q: Write a program that calculates the time neccessary to completely fill an empty pool with water. We…
A: The algorithm of the code is as follows:- 1. Start2. Ask the user to input the pool dimension…
Q: Evaluate: Note: [x]is ceiling and [ x ] is floor. [[ 1/2] + [ 1 / 2 ]+1/ 2] O 1 O 3 O 2 O None of…
A: Ceil always rounds a number up to the next largest integer. Floor returns the closest integer less…
Q: Programming Language: C++ Develop a Tic Tac Toe game that will match a player against the computer.…
A: #include<bits/stdc++.h> using namespace std; #define COMPUTER 1 #define HUMAN 2 #define…
Q: The quadratic formula is used to solve a very specific type of equation, called a quadratic…
A: PROGRAM EXPLANATION: - The Disc.py contains the discriminant function having three parameters for…
Q: Common Time Zones Function Name: commonTimeZones() Parameters: code1( str ) , code2( str )…
A: Hey there, I am writing the required solution of the questin mentioned above. Please do find the…
Q: The greatest common divisor (gcd) of the two integers 4 and 2 is 2. The greatest common divisor of…
A: Greatest Common Divisor is refers to the greatest positive integer that is a common divisor for a…
Q: Suppose we want to code the following function below. x2 f(x) = { 21x| – 1 |x|>1 |x| < 1 Write an…
A: Input : Value of x. Output : Value of f(x).
Q: Calculate the following if a =[1, -3,5] & b =[4,0,8] LION 2. a xb 1. a∙b
A: Dot product: The dot product, also known as the scalar product, is a binary operation that takes two…
Q: Having x = 2, y = 3, z = 0.5 What is the value of x, y, z after each of the following calculation…
A: 4 ) The given Algebric expression is : x = ( 4 + 2*3 ) + ( 16/4 + 1) - ( 3 + 8 ) / 4 According…
Q: The following function has errors. Locate as many errors as you can. void area(int length = 30, int…
A: Correction Explanation: The argument length should be declared inside the function body or at the…
Q: def f(x: float) -> int: return int(x) def g(x: str) -> float: return float(x) y = f(g("3.14"))…
A: Answer: Option 3 - y's inferred data type is int Explanation: The given equation is y=f(g("3.14"))…
Q: gers and a target sum, find whether or not a 2 × 2 square sub-grid exists such that its left…
A: Required function is given below: void printLocation(int numbers[][5], int size, int targetSum) {…
Q: Function ConvertHoursToMinutes(integer totalHours) returns integer totalMinutes totalMinutes =…
A: 1. Start the program.2. Define the function ConvertHoursToMinutes that takes an integer totalHours…
Q: Draw y1= sin(x):y2 = sin(2*x);y3 = sin(4*x);y4 = sin(8*x); the result must be in one figure Matlah
A: Given: y1 = sin(x); y2 = sin(2*x); y3 = sin(4*x); y4 = sin(8*x);
Q: Background: Game Rules The rules to the (dice) game of Pig: You will need 2 dice. To…
A: The Java Code for the Game of Pig(2 Dice) is given below: Here I am attaching code for all files:…
Q: Question 5 You are required to write a program that performs matrix multiplication and addition on…
A: You are requested to create a program that can add and multiply two matrices. The program must ask…
Q: 6.Coding-----"" Euler's totient function, also known as phi-function ϕ(n), counts the number of…
A: Given function to calculate the Euler's totient (phi function) for a given integer.
Q: 6. Square Root by CodeChum Admin You've learned in the past lessons on how to use square root…
A: As the language is not specified answer written in python 1)import math module 2)use…
Q: Function Name: commonTimeZones() Parameters: code1( str), code2( str) Returns: list of common time…
A: Hey there, I am writing the required solution of the questin mentioned above. Please do find the…
Q: Rewrite the following code segment using conditional operators (?/:) double discount_percent; if…
A: The conditional (ternary) operator is the only JavaScript operator that takes three operands: a…
Q: Interest on a credit card's unpaid balance is calculated using the average daily balance. Suppose…
A: To write program to find interest. i used C++ language.
Q: Problem Statement Write a C Program that will compute for the GCD of M numbers Input Input starts…
A: Answer: We have done code in c programming language and also we have attached editable code and code…
Q: KINDLY READ THE QUESTION CAREFULLY AND DON'T USE ANY SQUARE BRACKETS IN YOUR CODE . AND OUTPUT MUST…
A: Given: KINDLY READ THE QUESTION CAREFULLY AND DON'T USE ANY SQUARE BRACKETS IN YOUR CODE . AND…
Q: Modified coin-row problem: If we modified the coin-row problem, so that you cannot take the adjacent…
A:
solve the following questions?
1) 2x/3+1<6x/4
2) If x is the length of one side of a square, then what is the values of x in feet for which the perimeter of the square is more than 100 feet?
input in this format, example: x>4
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- (Python matplotlib or seaborn) CPU Usage We have the hourly average CPU usage for a worker's computer over the course of a week. Each row of data represents a day of the week starting with Monday. Each column of data is an hour in the day starting with 0 being midnight. Create a chart that shows the CPU usage over the week. You should be able to answer the following questions using the chart: When does the worker typically take lunch? Did the worker do work on the weekend? On which weekday did the worker start working on their computer at the latest hour? cpu_usage = [ [2, 2, 4, 2, 4, 1, 1, 4, 4, 12, 22, 23, 45, 9, 33, 56, 23, 40, 21, 6, 6, 2, 2, 3], # Monday [1, 2, 3, 2, 3, 2, 3, 2, 7, 22, 45, 44, 33, 9, 23, 19, 33, 56, 12, 2, 3, 1, 2, 2], # Tuesday [2, 3, 1, 2, 4, 4, 2, 2, 1, 2, 5, 31, 54, 7, 6, 34, 68, 34, 49, 6, 6, 2, 2, 3], # Wednesday [1, 2, 3, 2, 4, 1, 2, 4, 1, 17, 24, 18, 41, 3, 44, 42, 12, 36, 41, 2, 2, 4, 2, 4], # Thursday [4, 1, 2, 2, 3, 2, 5, 1, 2, 12, 33, 27, 43, 8,…Exercise 1: (Design of algorithm to find greatest common divisor) In mathematics, the greatest common divisor (gcd) of two or more integers is the largest positive integer that divides each of the integers. For example, the gcd of 8 and 12 is 4. Why? Divisors of 8 are 1, 2, 4, 8. Divisors of 12 are 1, 2, 4, 6, 12 Thus, the common divisors of 8 and 12 are 1, 2, 4. Out of these common divisors, the greatest one is 4. Therefore, the greatest common divisor (gcd) of 8 and 12 is 4. Write a programming code for a function FindGCD(m,n) that find the greatest common divisor. You can use any language of Java/C++/Python/Octave. Find GCD Algorithm: Step 1 Make an array to store common divisors of two integers m, n. Step 2 Check all the integers from 1 to minimun(m,n) whether they divide both m, n. If yes, add it to the array. Step 3 Return the maximum number in the array.Question 5 Numerical Approximation Methods basic ideas: Please write the basic idea (with key equations), application example, advantages and limitations of the following numerical approximation methods for solving linear/nonlinear equations. Please also state cases/examples for which one method can provide good result, but other may not. 1) Relaxation method 2) Binary search method 3) Newton's method 4) Secant method [Note: You can use simple examples for showing their applications. You might not need to derive any method]
- *Please help in javascript* Summary: Given integer values for red, green, and blue, subtract the gray from each value. Computers represent color by combining the sub-colors red, green, and blue (rgb). Each sub-color's value can range from 0 to 255. Thus (255, 0, 0) is bright red, (130, 0, 130) is a medium purple, (0, 0, 0) is black, (255, 255, 255) is white, and (40, 40, 40) is a dark gray. (130, 50, 130) is a faded purple, due to the (50, 50, 50) gray part. (In other words, equal amounts of red, green, blue yield gray). Given values for red, green, and blue, remove the gray part. Ex: If the input is: 130 50 130 the output is: 80 0 80 import java.util.Scanner; public class LabProgram {public static void main(String[] args) {/* Type your code here. */}}C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Python: numpy def serial_numbers(num_players):"""QUESTION 2- You are going to assign each player a serial number in the game.- In order to make the players feel that the game is very popular with a large player base,you don't want the serial numbers to be consecutive. - Instead, the serial numbers of the players must be equally spaced, starting from 1 and going all the way up to 100 (inclusive).- Given the number of players in the system, return a 1D numpy array of the serial numbers for the players.- THIS MUST BE DONE IN ONE LINEArgs:num_players (int)Returns:np.array>> serial_numbers(10)array([1. 12. 23. 34. 45. 56. 67. 78. 89. 100.])>> serial_numbers(12)array([1. 10. 19. 28. 37. 46. 55. 64. 73. 82. 91. 100.])""" # print(serial_numbers(10)) # print(serial_numbers(12))
- PROBLEM: Create a program that will ask to fill in two square matrices and perform matrix multiplication. Output the resulting matrix in proper format. SPECIFICATIONS that you need to follow: - The maximum size of the square matrices is 10x10. Matrices 1 and 2 should have the same dimensions. - You may only use the codes that we studied under our lectures - All lines of codes should have a comment. - Save your cpp file as Surname_FE (Example: Pangaliman_FE.cpp) TEST CASES: If a user inputs n = 2: Input: Input dimension (nxn) of the matrix, n = 2Input Matrix 1 elements: 1 2 3 4Input Matrix 2 elements: 5 6 7 8 Result: Resultant matrix: 19 22 43 50 If a user inputs n = 10: Input: Input dimension (nxn) of the matrix, n = 10 Input Matrix 1 elements: -35 54 64 31 45 -12 17 -31 -19 -78 -35 54 3 -10 -11 90 -41 31 -30 0 22 -53 21 -13 -64 32 -70 57 58 86 -77 30 73 24 -77 -90 -26 85 48 -47 -96 58 70 -59 82 -97 43 51 45 62 63 40 67 42 52 -78 -69…function avg and pass x and y Tin printf ("the avg of x and y is %d\n', avgl) give_sqrt (avgl); return 0, float avg (float m, float n) I/ Return the average of n and m void give sqrt (float x) printf ('the sqrt of is Mn'x :/ Print the sqrt value of x. return;You will use sequential, selection and repetition programming statements. You will define one integer number: count count will store how many times valid weights and values have been entered. You will define a variety of doubles: weight, value, sum, sumw, avg value will store the input value weight will store the input weight for that value sum will store the running sum of values and weights sumw will store the running of the weights avg will store the weighted average of the 5 numbers and 5 weights input. The running sum will be calculated by this formula: sum = sum + value * weight For example, if the first value and weight pair entered is 4, 1 and second pair is 10, 3: sum = sum + value*weight = 0 + 4*1 sum = 4 + 10*3 = 34 sumw = 1 + 3 = 4 Values and sum are to be input and calculated within a repetition loop: while count < 5 Input value, weight sumw = sumw + weight sum = sum + value * weight count = count + 1 End while Avg is calculated by: avg =…
- Problem Statement The barcode used by the U.S. Postal System to route mail is defined as follows: Each decimal digit in the ZIP code is encoded using a sequence of three half-height and two full-height bars. The barcode starts and ends with a full-height bar (the guard rail) and includes a checksum digit (after the five-digit ZIP code or ZIP + 4), computed by summing up the original digits modulo 10. Define the following functions: Draw a half-height or full-height bar on stddraw. Given a digit, draw its sequence of bars. Compute the checksum digit. Also define global code that read in a five- (or nine-) digit ZIP code as the command-line argument and draws the corresponding postal barcode.Write a menu driven C++ program that should perform following operation on matrices using 2D arrays. (Use OOP) The program will first take inputs for both matrices from the user then perform following operations on them: 1.CheckTranspose() This method will ask from user which matrix you want to take transpose and then display its transpose. 2.CheckSymmetric() This method will check symmetric matrix 3.CheckIdentity() This method will check if the matrix is identity 4. Multiplication() This method will multiply two matrices but first check number of rows and columns of corresponding matrices and display "Not possible" in case of inequality in rows and columns. Dont use pointers please use counters only.. Thank you very much.Vehicle Displacement You are given the velocity of shuttle traveling in a straight line as a series of data points. Write a program that computes the position (displacement) of the shuttle along this line at the time of the final data point The input is given vis standard input in the following format number of data points (0 < 65,535) on its own in • It pairs of data points, each on their own line, consisting of two integers separated by a ungle comma The first number represents the time in seconds (065535), and the second represents velocity in meters per second (4 v). Time is strictly increasing and velocity is constant between data points. The vehicle position and velocity both start at 0 May shuttles can drive in either direction, and in an added bit of realm the data points are speed-limited to about 25 mph in forward and 10 mph in reverse. However, in a reduced bit of realsm, the problem does imply that shuttles can change velocity instantaneously The output should be a single…
![Database System Concepts](https://www.bartleby.com/isbn_cover_images/9780078022159/9780078022159_smallCoverImage.jpg)
![Starting Out with Python (4th Edition)](https://www.bartleby.com/isbn_cover_images/9780134444321/9780134444321_smallCoverImage.gif)
![Digital Fundamentals (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780132737968/9780132737968_smallCoverImage.gif)
![C How to Program (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780133976892/9780133976892_smallCoverImage.gif)
![Database Systems: Design, Implementation, & Manag…](https://www.bartleby.com/isbn_cover_images/9781337627900/9781337627900_smallCoverImage.gif)
![Programmable Logic Controllers](https://www.bartleby.com/isbn_cover_images/9780073373843/9780073373843_smallCoverImage.gif)
![Database System Concepts](https://www.bartleby.com/isbn_cover_images/9780078022159/9780078022159_smallCoverImage.jpg)
![Starting Out with Python (4th Edition)](https://www.bartleby.com/isbn_cover_images/9780134444321/9780134444321_smallCoverImage.gif)
![Digital Fundamentals (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780132737968/9780132737968_smallCoverImage.gif)
![C How to Program (8th Edition)](https://www.bartleby.com/isbn_cover_images/9780133976892/9780133976892_smallCoverImage.gif)
![Database Systems: Design, Implementation, & Manag…](https://www.bartleby.com/isbn_cover_images/9781337627900/9781337627900_smallCoverImage.gif)
![Programmable Logic Controllers](https://www.bartleby.com/isbn_cover_images/9780073373843/9780073373843_smallCoverImage.gif)