Select the incorrect statement w.r.t. double helical structure of DNA. 1. The two chains of DNA run in anti-parallel fashion 2. The backbone is constituted by sugar-phosphate 3. The nitrogenous bases project outwards 4. Guanine is bonded with cytosine with three H-bond
Q: Draw a model of DNA. Be sure to include the names of the nitrogenous bases. thank you
A: DNA is a double helical structure that consist of nucleotides. Nucleotides consist of nitrogenous…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How…
A: Introduction: DNA is made of four nucleotide bases that are adenine (A), thymine (T), guanine (G),…
Q: A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: A. 1. Create the complementary strand for the DNA strand below. Make sure to label the parts and…
Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…
A: Replication is the synthesis of new DNA molecules from the parental DNA.
Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition
A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…
Q: I T?L|| ?L||?T |||| || |A| ||T|||c| |||| 6 4 5 “A. Denote the 5' and 3' ends of all of the DNA…
A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…
Q: 2. 3. Original - (template) DNA Adenine Thymine Cytosine Guanine 7._ Original (template) DNA strand
A: DNA replication is the process which produces daughter dsDNA from the parental dsDNA. It takes place…
Q: Which of the following statements are correct? explain your answers.A. A DNA strand has a polarity…
A: A.The statement: A DNA strand has a polarity because its two ends contain different bases is false…
Q: The orginal strand is 5' G-A-C-C-A-T 3' Question: What is the new replicated DNA strand? The…
A: In atomic science, DNA replication is the natural procedure of creating two indistinguishable copies…
Q: Which is NOT true of the different conformations of DNA? A. Z-DNA is a left-handed spiral.…
A: A-DNA: right-handed double helix. Dehydrated B-DNA takes an A type that, during severe conditions…
Q: – Draw a DNA strand with 10 adenine bases followed by 10 cytosine bases. If that same strand bonded…
A: DNA is a double helix, but only one of the two strands contains the information encoding each…
Q: explain how the biochemical structure of DNA allows it to function as the genetic materia
A: Introduction: Deoxyribonucleic acid, or DNA, is a molecule that provides the genetic instructions…
Q: The three-dimensional structure of DNA is said to be maintained by the presence of many hydrogen…
A: The biochemical basis of heredity is DNA. It is widely recognized as the genetic data reserve bank.…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…
A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…
Q: Approximately what percentage of DNA is noncoding? a 98% b 2% c 50% d 25%
A: DNA can be described as an organic molecule that includes genetic information as well as…
Q: prateins OP (weak bonds) a better source of energy than H,O (strong bonds)? 37. What is the…
A: Since you have asked multiple questions, we will solve the first complete question for you. If you…
Q: Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so…
A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'
A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…
Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…
A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…
Q: What are the component parts of a single DNA nucleotide? Group of answer choices A)a pentose…
A: Answer : Options A is correct :
Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…
A: Biochemistry is a branch of biology that deals with the structure, function and interaction of…
Q: There is segment of double-stranded DNA that is found to have a total of 140 bases. If 45 of those…
A: DNA( deoxyribonucleic acid ) is two stranded ladder like structure which contain four bases :-…
Q: Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided…
A: DNA is a double helical structure that comprises of tel strand running in opposite directions. Both…
Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…
A: According to Chargaff's rule, DNA of organisms should have 1:1 stoichiometric ratio of pyrimidine…
Q: Examine the 5 -3' sequence of bases of the DNA molecules (A D) shown below. I am only showing you…
A: For option A, AAAT the complementary strand is TTTA. In this A pairs with T by two hydrogen bonds…
Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…
A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…
Q: Table 1: Characteristics of DNA Questions To what maior group of biomolecules does DNA belong? wers…
A: INTRODUCTION DNA Deoxyribonucleic acid is the heriditary material present in humans and other…
Q: if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the…
A: DNA or Deoxyribonucleic acid is the genetic material which passes from one generation to another.…
Q: DNA Structure On the diagram: Label the 3' and 5' ends. G Circle a nucleotide Label the sugar and…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. If you need help with other sub…
Q: Watson-Crick model of DNA structure.
A: The molecule which contain genetic information and present inside the cell, known as DNA i.e…
Q: Can you: describe the 2 D and 3 D structure of DNA including the bonding that takes place
A: DNA as genetic material in all the living organisms.
Q: Which of the following rows describes the difference between DNA and RNA?
A: DNA or deoxyribonucleic acid is the double stranded helical structure that is the genetic material…
Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB
A:
Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…
A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.
Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…
A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…
Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…
A: Monomers are the simpler units which joins to each other to make polymers. There are many polymers…
Q: mino acid will become part of the polypeptide chain. 1. Partner DNA strand 2.…
A: Organism divides their genetic materials by cell division as a result they pass on their genetic…
Q: For entertainment on a Friday night, a genetics professor proposed that his children diagram a…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…
A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…
Q: Given the DNA molecule, draw the complementary piece under: TAGCTTAGCG
A: In DNA, 4 bases are there which involves Adenine, Cytosine, Thymine and Guanine. These bases are…
Q: Given the choices, a. 26 b. 23 c. 27 d. 21 how many hydrogen bonds are present in a DNA double…
A: The sequence is- GCTGTGCACT The complementary strand is- CGACACGTGA The rules of base pairing (or…
Q: T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine…
A: Chromosome is a storehouse of genetic information. Each chromosome is made up of DNA (…
Q: 384 Answer all the questions below please! Required: At least 3-4 sentences for each answer Write…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: 45.) What is the complementary strand for the DNA sequence 5'- CTAAAG-3'? B) 5'- CTTTAG-3' A) 5'-…
A: Complementary deoxyribonucleic acid is a kind of DNA in which the constituent molecules on one…
Q: Name: Activity #20: DNA Structure Directions: You may need your textbook to identify the nucleotides…
A: DNA is the double helical structure that is found in the living organisms like humans, plants,…
Q: Overall, a molecule of DNA has a negative charge. Which component of DNA gives it this charge? Refer…
A: DNA is a double stranded molecule. Each strand of DNA is composed by polymerisation of…
Q: Name 3 structural features of the DNA and how they help the DNA perform its functions
A: DNA is made up of four nitrogenous encode bases adenine ,guanine ,cytosine and thymine. These four…
Step by step
Solved in 2 steps
- The DNA helix is stabilized by I. hydrogen bonds between primary amine groups and keto groups II. stacking interactions III. favorable interaction between hydrophobic groups and hydrophilic groups IV. covalent bonds in the phosphodiester bonds III, IV II, IV I, II, IV I, II, III, IVSelect TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer. 2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways. 3. The coding strand of DNA is complementary in sequence to the corresponding MRNA. 4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation. 5. Polyribosomes speed up the rate of transcription.(Optional) Describe the structure of DNA, discussing the DNA helix and the base pairs of DNA, the overall structure of a chromosome, the structure of a gene, an mRNA, a ribosome, and a protein. What are the relative sizes of each of these?
- a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
- Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugarUsing the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle a nucleotide for each backbone strand A B A G G A E TFill in the blank with the most appropriate term that is described by the following statement: Closes nicks in phosphate backbone of DNA,
- Draw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’Illustrate the major features of DNA’s primary and secondary structure. Explain the concept of polarity as it applies to the structure of DNA.A nucleotide is the monomeric building block of the polymer of DNA. To better understand the characteristics of DNA, it is important to understand how the monomers join to form the polymer. Use the following diagram of DNA (and the diagram of a nucleotide in the PowerPoint presentation) to label the listed features: 3' and 5' ends, nucleotide, phosphate group, sugar group, phosphodiester bond, nitrogenous base (pyrimidine and purine), and hydrogen bonds. NHZ NH2 HN OH₂N NH₂ 5. Looking at the polymer, why is a DNA considered antiparallel? 6. Why are the ends of DNA strands named 3' or 5'? 7. How do A:T interactions differ compared to G:C interactions? How does this affect stability of the bond pairs? 8. During gel electrophoresis, to which electrode (+ or -) does DNA migrate? Why?