Roanoke Island 1) Use the scale to determine distance. How far would the colonists to Croatoan Island? Show your work in the space provided. Answer question 1 here Croatoan Island 10 miles Scale 2.) Is it possible they would have gotten lost in their journey? Why or Why not? 3.) What other problems might they have run into on this journe Answer question 2 here Answer question 3 here
Q: 0.09 How many in the population are homozygous dominant? How many people have wet ear wax (This is…
A: Hardy Weinberg Equilibrium or HWE states that the frequency of occurrence of specific alleles in a…
Q: 17 Match the number of the label in the diagram below with the appropriate site or structure from…
A: Electron transport chain Also called the ETC is composed of four protein complexes. These protein…
Q: The first recombinant human growth hormone (available in 1985) had an extra amino acid (relative to…
A: Human growth hormone (hGH or HGH), commonly referred to as somatotropin or growth hormone (GH), is a…
Q: From the choices below, which are reputable sites that can be used to locate scientific journal…
A: Science is a term which is used for the study of the subject which is based on the facts and…
Q: Part 1: Graphing Biotic Potential 1. Make a table to show the data (# flies/generation). for one…
A: Given that one female fly can produce 120 eggs in one generation. Of these 120 eggs, half (60) will…
Q: Answer questions 12-16 , I need the letter of your answer
A: Environment refers to the area where organisms live. Ecosystem is the organised community of living…
Q: 22) If both married couples have the sickle cell trait (AS), what is the possible combination of…
A: The mode of inheritance is a pattern of obtaining parentral alleles or genes to the offsprings. The…
Q: Digestive Enzyme Activity Tan-protease ...... - W-protease --- 4 8. 10 12 pH Based on these data and…
A: In this question, scientist identified two enzymes which are found to function in the digestive…
Q: Use the following information to answer the question: Many species of food crops have been…
A: Organisms and their environments are inextricably linked and interdependent. Every alteration in the…
Q: When you examine the phenotype of wings - why can you conclude that wings & flight are analogous…
A: Change in visible characteristics of an organism which takes place from many generations is called…
Q: 1: The Chemistry of Life 7. Identify the molecule shown here: HỌC—CH,CH,CH,CH, CHỊCH,CH,…CH, CH, CH,…
A: The body of an organism is just like a chemical factory. Numerous chemical reactions are…
Q: Which of the following is the NOT the correct way of writing the scientific name? After the…
A: 1) There are precise conventions to follow while writing a scientific name. The genus name is…
Q: 7. What type of insulin is used for insulin pump therapy? a) Long-acting insulin b) Rapid-acting…
A: Diabetes mellitus It is a chronic metabolic disorder characterized by increased blood glucose or…
Q: n tamarins were released into their natural habitat but found most were very underweight, presumably…
A: Gel electrophoresis is a technique used to separate DNA fragments according to their size. In order…
Q: Matching (may be used more than once or not at all) a. plasma membrane b. centriale c. endoplasmic…
A: Cells can be described as the smallest functional unit of living organisms which are responsible for…
Q: glucose will be more readily phosphorylated by glucokinase than hexokinase hexokinase will…
A: The main difference between the enzymes Glucokinase and Hexokinase is their location. Hexokinase is…
Q: QUESTION 20 When food is moving from the esophagus to the stomach, cardiac sphincter is open and the…
A: Human anatomy is the field involving the structure of the human body. Sometimes it also includes the…
Q: 4)In 2018, the atmospheric concentration of CO2 was 408 pm, and the concentration of methane was…
A: Parts per billion (ppb) is a unit of measurement used to express the concentration of a substance in…
Q: Examine the table showing the classification of four questions. Taxon Domain Kingdom Phylum Class…
A: Classification is the process of grouping things together based on shared characteristics. In…
Q: 2. What is the purpose of teeth? a. increase food's surface area b. decrease food's surface area c.…
A: Introduction The digestive system is the group of organs responsible for the ingestion, breakdown,…
Q: nswer any three.
A: As we know Hemoglobin is a product made from heme+globin. The presence of heme gives the red color…
Q: X-Linked Recessive Disorder: Color Blindness 3. Color blindness is an X-linked recessive disorder in…
A: An individual who suffers from color blindness is unable to distinguish between red and green…
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…
Q: Which of the sugars below are diastereomers of compound I? CHO H+ OH H-+OH H+OH CH₂OH I CHO H-OH…
A: Stereoisomers are the type of isomers in which the chemical formula of the molecules as well as the…
Q: Which of the following changes or mutations can be acted upon by natural selection? For each choice,…
A: Evolution is the gradual accumulation of changes in organisms over a period of time. The theory of…
Q: Compare and contrast peptide hormones, steroid hormones, and amine hormones. Be sure to talk about…
A: The endocrine system is a vital ductless system of the human body that is concerned with the…
Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…
A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…
Q: Figure 2.25 Ocean acidification. CÓ, HO H₂CO H₂CO₂H+ HCO3 HACO HCOS CO₂ + Ca CaCO₂ Scientific Skills…
A: This question is about interpreting a scatter plot with a regression line from an experiment that…
Q: D) The concentration of this ion and negatively charged proteins is much greater inside the cell…
A: The Neuron's membrane consists of sodium to be present in large quantity in the extracellular part…
Q: 15. LO1.3 The respiratory systems primary function is to: a. Fight infection. b. Warm the air. c.…
A: Physiology is the study of normal functions within the living. It involves the study of various…
Q: 1. Accessory structures of the eyes include O A. Intrinsic eye muscles, Eyebrows, Lower Conjunctiva,…
A: Eyes also called as photoreceptors are the organ of site located inside orbits or eye sockets which…
Q: Table 15-1 (fill in the numbers as indicated) TABLE 15-1 NUMBER Bone Count Related to the Lower…
A: Bone is a metabolically active connective tissue that aids in mobility, protects essential organs,…
Q: 2. (A) What is the name of the key orexigenic neurons in the arcuate nucleus ARC. (B) These neurons…
A: The central nervous system (CNS) is one of the two major divisions of the nervous system. It…
Q: Starting appear in squalene. 14 H3C COA 5.) Starting with the following radiolabeled acetyl-CoA map…
A: Introduction: Biosynthesis of cholesterol occurs from the acetyl-CoA in four stages.
Q: Which of the following is not true of diabetic retinopathy? retina blood vessels swell blood glucose…
A: Answer 1 Option C is correct : Higher than normal HDL cholestrol levels
Q: is the 2nd amino acid in the peptide produced from the C-terminal is the anticodon present in the…
A: A Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or…
Q: SUGAR AND WATER EXPIRIMENT 1. Make sure the glasses have an equal amount of water. Put a sugar cube…
A: Water It is the most important material on the planet eart. Water makes life possible as almost…
Q: Short Answer Questions 1. The "fast hematocrit" involves withdrawing a very small amount of blood…
A: Blood is the liquid connective tissue of the body that is essential for the transport of nutrients,…
Q: For the following questions use the pedigree shown below: %3D 2 3 4 5 Assume that individual 1-2 is…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: What are some recommendations to clinicians interested in incorporating body composition methods in…
A: Introduction :- Body composition means that the chemical compounds that makes up the human body , in…
Q: One of the biggest obstacles to the widespread use of ultrasound for body composition estimation in…
A: Impedance is defined as the resistance to current flow. The bioimpedance devices/techniques employ…
Q: What organism did Vries used as evidence to prove that species did change as Darwin said? * evening…
A: Question number 1 On the basis of above observations, Hugo de Vries (1901) put forward a theory of…
Q: Draw the structure (using chair confirmation of pyranose) of the following disaccharides. (a)…
A: Disaccharides are carbohydrates that, when hydrolyzed with acids or enzymes, provide two…
Please answer questions 1-3.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps