RNA Pol III transcribes the following class of RNASTRNASFRNASsmall nuclear RNASAll of the above

RNA pol III :- eukaryotic RNA polymerase, help in eukaryotic transcription.

Answered: RNA Pol III transcribes the following…

Science

Biochemistry

RNA Pol III transcribes the following class of RNAS TRNAS rRNAs small nuclear RNAS All of the above

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 1SQ: A chromosome contains many different genes that are transcribed into different ___ . a. proteins b....

See similar textbooks

Related questions

Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…

A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…

Q: Which polymerase transcribes genes with internal control regions (ICR)? O RNA Pol I RNA Pol III RNA…

A: The eukaryotic cells have three distinct RNA polymerases that transcribe different sets of genes.

Q: 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…

A: The RBCs are the cells which carry oxygen to various tissues. The RBCs yield energy from the…

Q: Please solve all part. 9. If 32p-labeled inorganic phosphate were…

A: Glycolysis is undergoing here i.e conversion of the glucose to pyruvate molecules, and we assume…

Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond…

A: The αα-helix is an ordered secondary conformation of proteins. An αα-helix is stabilized by the…

Q: D. Lactate

A: Glycolysis is the phenomenon in which sequence of reactions converted glucose to pyruvate and…

Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…

A: Bioremediation is a waste management technique. Living organisms can be used in this process to…

Q: Explain in detail the role of biotechnology in production of baker’s yeast.

A: For millennia, humans have used the metabolic activity of yeasts in baking and brewing. The creation…

Q: D Question 6 6. The following table summarizes properties of three different proteins. Two would be…

A: Chromatography is an analytical technique for separating components of a mixture

Q: Aldolase is a key enzyme in glycolysis that catalyzes the cleavage of its substrate,…

A: During glycolysis, Aldolase catalyzes the cleavage of its substrate fructose-1,6-bisphosphate into…

Q: What Type of guard column, separation column, and suppressor used for anion- exchange chromatography

A: In the anion-exchange chromatography, the process of separation occurs which is based on the charges…

Q: dehydrogenase, which converts pyruvate to lactate in the presence of NADH. The velocity of the…

A: Kcat is also known as catalytic constant or turnover number. It can be defined as the amount of…

Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…

A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…

Q: Briefly describe "Lipids" and give examples

A: Lipids biological macromolecules non-polar molecules that is consist of hydrocarbons. It is soluble…

Q: What is the relationship between the cooling of organs and tissues for medical transplants and the…

A: For patients with end-stage disease, organ transplantation is the most effective therapy. Donor…

Q: Explain the meaning of metabolic interconversion

A: Metabolism is the body's cells is used for changing the food into energy. The human bodies need this…

Q: 2. You want to clone a specific PCR amplicon. You have determined that the amplicon you want to…

A: pUC57 is a commonly used plasmid cloning vector in E. coli.

Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…

Q: Q1. (a) Describe and illustrate each of the following immunoprecipitation techniques (i)…

A: a) Immunoprecipitation (IP) refers to the small-scale affinity purification of antigens with the…

Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…

A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…

Q: Describe the properties of water that are critical to maintaining life Include a discussion of…

A: Water most important element on earth without that life on earth can not be possible , without water…

Q: Identify Four (4) possibilities in cell culture practices that able affect the quality and yield of…

A: Cell culture It is a method of growing the cells in artificial condition i.e. cells are grown…

Q: In which of the following pairs Is the first eleme than the second? (1 Point) O 0, P O Cs, Rb O I,…

A: Electronegativity - It is property of an atom in a molecule. The tendency of an atom to attract the…

Q: 4. Which of the following is an example for group specificity? a) Trypsin hydrolyzing peptide…

A: Group specificity - It implies that the enzyme will catalyze a particular reaction on the function…

Q: Why people with PK deficiency may tolerate a lower hemoglobin level than people with other types of…

A: Pyruvate kinase deficiency (PKD) is the most prevalent congenital glycolysis enzymatic abnormality…

Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: 1. List several methods (other than Bleeding Time -Ivy method, Capillary Tube Method, Lee and White…

A: Introduction: Bleeding time: It is the time interval between the skin puncture and spontaneous,…

Q: Draw and label a structure of: A diglyceride of oleic acid

A: A diglyceride is composed of a glycerol molecule attached to two fatty acids through ester bonds.…

Q: Explain what Hepatocyte hopping is

A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…

Q: How is a “committed step” defined in the context of a metabolic pathway and why are they important?…

A: A metabolic pathway is a chain of biochemical reactions linked together by their intermediates.…

Q: 1. Stages of the insulin biosynthesis and maturation. Components: A. N-terminal amino acid. B.…

A: Introduction: Insulin is a hormone that is synthesized in the beta cells of the pancreatic islets…

Q: Where would the catalase enzyme perform best- in the human blood stream OR in the human stomach?…

A: Catalase is common enzyme found in all aerobics and it convert reactive oxygen species H2O2…

Q: Pyruvate is produced in glycolysis and used by Kreb's Cycle in the mitochondrial matrix. How does…

A: Glycolysis is the process by which glucose is converted to pyruvate along with production of…

Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…

A: In the last 40 years, scientific understanding of retroviruses has increased dramatically. The word…

Q: DNA ligases cannot join the sticky ends of two DNA fragments. True False

A: The DNA ligases are used in the process of cloning in which pieces of DNA having matching ends are…

Q: A positive result for the Ninhydrin test yields a deep blue or violet-blue color of the soluti more…

A: Ninhydrin test is a chemical test performed to detect the presence of amines or amino acids.

Q: the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle? What…

A: TCA / Krebs cycle : An ingenious series of reaction catalyzes by eight different enzyme that…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: In Lieberman's Test, what should you do to revert the change caused by the addition of water to the…

A: Liebermann's test is a confirmatory test for the detection of a phenol group. It is also employed in…

Q: Why are they so designated? Ketone bodies are so named because they contain the ketone functional…

A: Ketone bodies are produced by the liver during caloric restriction.

Q: d) Which reactions are predicted to be far-from-equilibrium? Explain your rationale. e) What type of…

A: Glyoxylate cycle is an anabolic pathway that occurred in plants, bacteria, protists, and fungi in…

Q: In olfactory neurons, it is estimated that activation of the olfactory receptors results in an…

A: The olfactory epithelium of the nasal roof contains olfactory receptors. Each olfactory receptor is…

Q: 9. L-lactate dehydrogenase: L-lactic acid:: Salivary a-amylase: a) D-aminoacid b) L-aminoacid c) a-…

A: All biological chemical reaction reactions in living beings are controlled by enzymes. If enzymes…

Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エエ工王 \\

A: Retention factor The amount which each component of a mixture travels can be easily quantified using…

Q: Consider the typical beta oxidation of linoleic acid (C18:2 ^Δ9, 12): How many ATP are generated in…

A: 117 ATP

Q: How many molecules of water are produced by the electron transport chain during the complete aerobic…

A: Stearate is saturated fatty acids. It is metabolized by beta oxidation in the cytoplasm. It releases…

Q: Сно сно CH,OH Fo но H- HO- H- Phosphorogluco- isomerase Phosphofructo- kinase Нехоkinase но H- но…

A: The given pathway represents the glycolytic pathway, through which the glucose molecules are…

Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…

A: One of the factors that determine the solubility of proteins in solution is the concentration of…

Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…

A: Nucleic acids are constituted of nucleotides linked via phosphodiester linkages while proteins are…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Question

RNA Pol III transcribes the following class of RNAS
TRNAS
FRNAS
small nuclear RNAS
All of the above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

The following diagram describes the mRNA sequenceof part of the A gene and the beginning of the B geneof phage ϕX174. In this phage, some genes are read inoverlapping reading frames. For example, the code forthe A gene is used for part of the B gene, but the readingframe is displaced by one base. Shown here is the singlemRNA with the codons for proteins A and B indicated.aa# 5 6 7 8 9 10 11 12 13 14 15 16A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeumRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUGB MetGluGlnLeuThrLysAsnGlnAlaaa# 1 2 3 4 5 6 7 8 9Given the following amino acid (aa) changes, indicatethe base change that occurred in the mRNA and theconsequences for the other protein sequence.a. Asn at position 10 in protein A is changed to Tyr.b. Leu at position 12 in protein A is changed to Pro.c. Gln at position 8 in protein B is changed to Leu.d. The occurrence of overlapping reading frames isvery rare in nature. When it does occur, the extentof the overlap is…
Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
RNA polymerase in Escherichia coli normally synthesizes all of the following molecules except: RNA primers during DNA replication messenger RNA (mRNA) transfer RNA (tRNA) ribosomal RNA (rRNA) heterogenous nuclear RNA (hnRNA)
Name and describe three mechanisms of RNA processingin eukaryotes, and explain their importance to the cell.
Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
Name each of the processes pictured: -RNA 5' TCAC CÁCTCAT 3' TACCACCTA 3' UUCAC CACUCAU U 5' DŇA RNA polymerase Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 Spliced RNA 000 Exon 1 Exon 2 Exon 3 AAAAAAA polypeptide chain Met Phe Arg P E UAC AAA GCU AUGUUUCGA Ribosome There are possible nucleotide "triplets" or
In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus
The sigma subunit of bacterial RNA polymerase ________________________. is required for the initiation of transcription binds to the RNA polymerase core enzyme must be released from the RNA polymerase for transcription to enter the elongation phase binds to the bacterial promoter sequence All of the other answers are correct.
What does it define- defining theprocess of transcription- DNA to RNA The code is nonoverlapping
GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?
What are functions of the M7G cap? Select all the apply. O Slows degradation from the 5' end of the mRNA O Slows degradation from the 3' end of the mRNA O helps start translation by recruiting the mRNA to the small ribosomal subunit O is the first nucleotide to be transcribed