Answered: RNA interference is initiated by the…

RNA interference is initiated by the introduction of _______ into a cell. Group of answer choices Double-stranded DNA The RISC complex Single-stranded RNA Double-stranded RNA Single-stranded DNA

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: are responsible for transcription in both prokaryotes and eukaryotes. Question 17 options:…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: sgRNA GFP Exon 1 Exon 1 Intron 1 Exon 2 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in the nucleus to…

Q: why do cells require RNA interference

A: A biological mechanism known as RNA interference (RNAi) involves the involvement of RNA molecules in…

Q: Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA…

A: In the image shown, we can see two strands of DNA, unwinded, RNA polymerase, RNA being transcribed…

Q: 9. The following DNA sequences found on the sense strand belong to the same eukaryotic gene:…

A: DNA or Deoxyribonucleic Acid acts as the genetic material of biological entities. It is made up of…

Q: 18S rRNA is transcribed by Question 29 options: RNA polymerase I RNA polymerase…

A: As we know that RNA polymerase is responsible for transcribed all different type of RNA in…

Q: Conventional ligation procedures make use of enzymes with which activity?

A: DNA repair is a cellular mechanism that corrects various types of DNA damage that can occur due to…

Q: Which of the following region is not found in the Eukaryotic RNA? 3' UTR Introns Intercistronic…

A: Eukaryotic RNA refers to the ribonucleic acid (RNA) molecules found in eukaryotic cells. Eukaryotic…

Q: Determine whether each of these events of eukaryotic DNA replication is associated with leading…

A: It is the process by which a double stranded DNA molecule is copied to produce two identical DNA…

Q: Intrinsic RNA chain termination is determined by specific sequences in the DNA called ____ sites.…

A: Termination during transcription occur via 2 methods. Intrinsic termination:- promote termination by…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The type of RNA modification that requires guide RNAs is ________.

A: Hi, Thanks For Your Question. Answer : Correct Answer Is RNA Editing Explanation : RNA Editing Is…

Q: The residual end of a pre-mRNA transcript is digested by the following enzyme

A: Transcription is the process of formation of pre-mRNA (precursor mRNA) (heterogenous mRNA) from the…

Q: Plasmids are likely to contain

A: Plasmids are likely to contain:Antibiotic genes, A promoter associated with each gene, Restriction…

Q: 38) Termination begins when there is an AUG at the A site begins with a termination codon…

A: Termination is the final step in the translation process. When a stop codon (UAA, UAG, or UGA) in…

Q: In eukaryotic cells, __________ copying initiates nearlysimultaneously at thousands of origins of…

A: The origin of replication refers to the specific sequence present in the genome that triggers the…

Q: handwritten diagram of prokaryotic transcription and indicate on the drawing: DNA(template/coding…

A: The segment of DNA which is transcribed into RNA is called transcription. The RNA transcripts are…

Q: You want to develop a drug to block the lifecylce of the retrovirus HPV (Human Papilloma Virus).…

A: Retrovirus are those which have rna as genetic material and use reverse transcriptase to make DNA.

Q: Multiple antibiotic resistance genes are contained on a bacterial plasmid in a __________.…

A: Introduction Bacteria are unicellular, prokaryotic organisms. They do not have true nucleus and…

Q: Which of the following is stabilized by SSBs? O Lagging strand O Leading strand O Helicase ORNA…

Q: Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6.…

A: Coronaviruses are a bunch of viruses that cause diseases like Severe Acute Respiratory Syndrome…

Q: Using the prokaryotic DNA sequence above, describe the relationship between the highlighted regions.…

A: Transcription, the process by which genetic information is converted into RNA molecules, is a…

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: There are few important points which could kept in mind these are as follows: As protein synthesis…

Q: QUESTION 33 Which of the following is the transfer of genes from generation to generation? O…

A: Question 33 Answer: Introduction: In horizontal gene transfer, the transfer of genetic material or…

Q: Nitrogen mustard gas, Cisplatin and other alkylating agents cause: Question 16 options: double…

A: Alkylating agents are a class of chemicals that can add alkyl groups (e.g., methyl or ethyl groups)…

Q: An enzyme is needed for the Krebs Cycle. It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: gene editing and RNA interference.

A: Gene editing: It is defined as the type of genetic engineering in which DNA is inserted or…

Q: In prokaryotes, the sigma factor recognizes base sequences in the _____ which facilitates RNA…

A: Prokaryotes are unicellular organisms that lack a true nucleus. Their genetic material is not…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: B) STARTS AT ORIGIN Initiator proteins identify specific base sequences on DNA called sites of…

A: Process of DNA dependent DNA synthesis is called as the DNA replication. DNA replication is a…

Q: Which RNA polymerase is responsible for transcribing protein coding genes? Group of answer choices…

A: RNA polymerase transcribes RNA by moving along a DNA strand. During the transcription process, an…

Q: Not all excision repair results in an obvious "right" and "wrong" side of the DNA. How could a…

A: The decision of which DNA strand to preserve or fix in bacterial cells can be made depending on the…

Q: Transcription V [Choose ] Coagulase RNA polymerase Translation DNA polymerse Ribosome Reverse…

A: The central dogma of molecular biology suggests the flow of genetic information from DNA to rna to…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Adds…

A: Asked : Correct enzyme for the given statement

Q: The DNA can be increased in size by only about 5%, representing the addition of only 3 kb of new…

A: Cloning vector Based on lambda bacteriophages: Two problems had to be solved before lambda based…

Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…

A: Genes are hereditary structures on genetic material. These control some specific particular traits.…

Q: Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases…

A: Introduction DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Insertion or removal of one or two nucleotide base pairs in a protein coding region of DNA usually…

A: Frameshift mutation is defined as insertion or deletion of a number of nucleotides that is not in…

Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…

A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…

Q: Explain why H is 5' and leading strand and E is 3' and laggin strand

A: Nucleic acid serves two major functions: carrying genetic information and messenger to relay the…

Q: Which of the following is/are required for RNA synthesis? (sel

A: RNA synthesis is made from the DNA molecule. so RNA synthesis is the synthesis of RNA like mRNA from…

Q: Mismatch Carbon Donor Clonin plasmids endotoxin Mutagen Nucleotide Termination Source DNA cell…

A: Since you have asked multiple questions , we will solve the first question for you. If you want any…

Q: After exposure to gamma radiation, the following mutation occurs in the template strand: 5’ GTA GGG…

A: Radiation cause mutation in the DNA this varies from point mutation to chromosomal aberrations. The…

Question

46.

RNA interference is initiated by the introduction of _______ into a cell.

Group of answer choices

Double-stranded DNA

The RISC complex

Single-stranded RNA

Double-stranded RNA

Single-stranded DNA

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

What is it? Leading chain Ligase procedure Replication fork structure that may participate in translation The lagging chain
True or false double strand rna is synthesized using taq polymerase. plasmids are linear dna moley in a eukaryotic cell dna is packaged into exosomes. Decreasing the concentration of agarose in a gel will allow better separation of smaller fragments of dna
ntrol A option N S X H command C V G B I N M command ? ?? option Name four differences in the structure and location of DNA VS RNA
Give typed explanation
In Rho-independent termination of transcription (does NOT need the Rho protein), why does the mRNA fall off" of the template DNA?"Question 16 options: because the polymerase pauses over an AT-rich region of DNA because a helicase protein disrupts the H-bonds in the RNA:DNA hybrid because a stem-loop in the mRNA changes the conformation of the NusA protein because a stop codon is reached
fill out the table
answer the table specially row d please with table in answers
Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component of RNA replication has a structure similar to that of remdesivir?
SSBs are: single-stranded DNA binding proteins that prevent re-annealing supercoil stabilizing bodies. single-stranded bodies called Okazaki fragments. substrates for DNA ligases.
Match the diagram with the correct term listed below. Structures Letter Okazaki fragments Answer DNA polymerase Answer RNA primer Answer Helicase Answer Leading strand Answer Lagging strand Answer 3′ Answer 5′ Answer
Arthur may be fed up, but he's absolutely necessary. Explain why cells need Arthur and his co-worker Carol to be messengers, while their boss can't leave the nucleus. Paramecium Parlor I'm telling you, Carol I'm DONE being this guy's messenger boy Bod Moeba Sreters He can leave the (nucleus and do it himself for all I carel Arthur, the mRNA, was at the end of his strand at work.
DNA Replication Terms _____DNA polymerase III _____Primase _____Helicase _____Lagging Strand _____Leading Strand _____RNA Primer _____Single Strand Binding Protein _____5’ _____3’ _____DNA Ligase _____ Topoisomerase _____Template Strand _____Coding Strand