Q: Question 10 Hormones, such as testosterone, estradiol and progesterone are examples of steroidal…
A: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. True OR…
Q: Question 2. In the presence of low levels of GTP, microtubules inside a cell will undergo due to
A: Introduction :- The network of protein filaments, present in the cytoplasm of eukaryotic cells is…
Q: QUESTION 5 The activation of the sodium potassium pumps creates ion redistribution by pumping three…
A: Sodium potassium pump It is also known as the Na⁺/K⁺ ATPase It is found in the membrane of all…
Q: Question 15 Osmosis is the movement of - ----- across a semi-permeable membrane O 1. Solute O 2.…
A: Semi-permeable membrane is a synthetic or biological membrane that allows movement of only some…
Q: QUESTION 22 Match each of the following to its role in the cell. A. Cytoskeletal fiber that is…
A: A cell is life's basic unit. A cell has different organelles present in it to do varieties of…
Q: Question 6 Phospholipid bilayer is a fluid matrix. O True False
A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…
Q: QUESTION 50 True or False: In E. coli. When glucose is scarce, cyclic AMP accumulates and binds CRP.…
A: The answer to the question is TRUE. Lac operon is a set of structural genes regulated by a common…
Q: Question 1. Cytoplasmic kinases are typically activated in the cytoplasm:
A: Cytoplasm is a thick solution that fills each cell and is enclosed by the cell membrane.
Q: QUESTION NO. 1 Statements: (1) Glucose is both a hexose and a aldose. (2) There can never be more…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: You are in charge of generating a scaffold for use in tissue engineering applications that behaves…
A: Scaffold for tissue engineering are the support structure designed to facilitate cellular growth and…
Q: QUESTION 20 Fentanyl is: O found in Erythroxylon coca O a drug for addiction treatment O a synthetic…
A: Introduction A drug is any chemical substance that alters the physiology or psychology of an…
Q: Question 19 Proteins are made in the mitochondria of cells. True O False
A: Proteins are the macromolecules which are basically the polymer of amino acids.Proteins play very…
Q: QUESTION 29 Candida albicans is a [A] that is (83, it can grow in a yeast [C] [D] form, it is the…
A: Candida albicans is non phototropic (i) that is Fungi (A), it can grow in a yeast, hypae (C)and…
Q: A transgenic mouse was produced which lacks a protein that is required to assemble tight junctions…
A: Cell junctions These are the connections present between the two cells or the cell and plasma…
Q: QUESTION 9 Which of the following is/are found in prokaryotic cells? O 1. Mitochondria O 2.…
A: Hello. You have posted multiple questions we will be able to post the answer to the only first one.…
Q: Question 6. The sodium-potassium pump makes the cell interior more sodium ions out of the cell for…
A: Sodium potassium pump is the example of active transport which is an energy requiring process in…
Q: QUESTION 12 When a drop of dye is placed in water, the dye particles move from the area where the…
A: Diffusion : The movement of particles from a region of higer concentration to a region of lower…
Q: Question 8 Lipoplexes trapped in endosomes prevent destruction by lysosomes due to the inclusion…
A: Lysosomes are the organelles present in cells and filled with hydrolytic enzymes.
Q: Question 21 Glycogen that is stored in skeletal muscle cells O is broken down and released into the…
A: When the body in takes more glucose than needed, the glucose in the blood stream is absorbed by the…
Q: Question 15 The most important job of a bacterial cell wall is to O prevent osmotic lysis to prevent…
A: Bacteria (prokaryotes) are one-celled microorganisms that exist almost everywhere. They can divide…
Q: QUESTION 13 Genes determine polypeptide structure, which determines the structure of enzymes and…
A: Sequence of DNA determines the structure of proteins. The sequence determines the amino acid…
Q: Question #19: The enzyme-linked immunosorbent assay (ELISA) is a powerful method for detecting and…
A: ELISA is for enzyme-linked immunoassay which is a commonly used laboratory test to detect antibodies…
Q: QUESTION 15 A carrier protein is required for O A. osmosis and active transport. O B. osmosis and…
A: As per the guidelines, we are supposed to answer only the first question in case of multiple…
Q: QUESTION 41 Which of the following cells is the most specialized? O Multipotent cell O Totipotent…
A: Cells, in the beginning, have the ability to become all different kinds of cells needed to make an…
Q: QUESTION 7 When it comes to diseases cased by mutations in the mitochondria, identical twins O Will…
A: Given: Diseases caused by mutations in the Mitochondria in Idenctical twins.
Q: QUESTION 25 When bound to its ligand, this type of receptor changes conformation to allow ions to…
A: Answer 25th answer is ion channel linked receptor
Q: QUESTION 25 When cells lack a specific type of myosin, the stress fibers are decreased and focal…
A: Myosin is a superfamily of proteins which bind actin, hydrolyze ATP and transduce force.
Q: Protein makes up what percentage of the mass of the plasma membrane in a typical cell (e.g. red…
A: Most plasma membranes consist of approximately 50% lipid and 50% protein by weight, with the…
Q: Question 60 Do abnormal prions trigger an immune response, for example antibody production no O yes
A: Prions are not living entities like bacteria and do not contain any genome like viruses. Prions mean…
Q: Question 14. Match the transport process to the correct description or example. Secondary Active…
A: Chemical energy is required for active transport since it is the movement of biochemicals from areas…
Q: Question 29 Sponges (Porifera) All of the above pump water through their sponge material with the…
A: Members of this phylum are known as sponges. They are mostly marine and mostly asymmetrical animals.…
Q: QUESTION 6 Enzyme chymotrypsin cleaves polypeptides after aa. O Positively charged O Large,…
A: Chymotrypsin is a digestive enzyme. This enzyme belongs to the family of enzymes called serine…
Q: Question 8 The presence of tiny hairs, called setae, on the toe pads of some geckos is associated…
A: Hundreds to a huge number of hair-like fibers, called setae, line the underside of a gecko's toes.…
Q: QUESTION 5 It is best to receive an organ transplant from a donor who O looks like you rarely…
A: Organ transplant is a process in which a donor donates the required organ to the receiver who is in…
Q: QUESTION 19 Charged phosphoinositides are recognized and bound by Pleckstrin Homology domain PTB…
A: Phosphoinositides are a family of minority acidic phospholipids in cell membranes. Their principal…
Q: Question 44 Uncertainty of measurement is calculated to give the scientist wiggle-room in their…
A: Measuring uncertainty is important in the experiment and Measurement. Give the scope of correction.
Q: QUESTION 44 In adult neurons, there is a higher concentration of chloride outside the cell than…
A: Gamma-aminobutyric (GABA) acid is considered as a neurotransmitter, which is actually an amino acid.…
Q: You are studying the effects of removing integrins from cells. Which of the following abilities is…
A: The function of integrins receptors is to bind or respond to the extracellular matrix of the cell.…
Q: QUESTION 18 A patient has had a serious accident and lost a lot of blood. In an attempt to replenish…
A:
Q: QUESTION 27 Microtubules are made of tubulin. When tubulin is bound to GTP, it has a higher affinity…
A: Note- Since you have asked multiple questions, we will solve the first question for you. If you want…
Q: QUESTION 25 Compared to skeletal muscle, cardiac muscle O has gap junctions that allow it to act as…
A: Muscles of the skeletal, smooth, and cardiac systems make up the muscular system. It allows the body…
Q: QUESTION 6 According to Deamer, compartments are so important to life because evolution requires…
A: true
Q: Question 40 ningles is reactivation of A person suffering from shingles is O Varicella/chickenpox…
A: Shingle is a viral infection that causes a painful rash. Although shingles can occur anywhere on…
Q: QUESTION 14 Endoplasmic Reticulum always has ribosomes attached to its surface which is why it's…
A: Answer 14: Endoplasmic reticulum is an organelle in cell and is involved in protein synthesis,…
Q: QUESTION 23 When water evaporates from your body, you are cooled by the water's low viscosity and…
A: False because the surface tension of water is very high and is second highest in liquid after…
Q: Which of the following molecules is NOT a component of desmosomes? A Intermediate filaments B…
A: Desmosomes are the type of anchoring cell junctions.
Q: Which of the following is NOT true of intermediate filaments? A They provide mechanical strength…
A: Intermediate filaments are rope like cytoplasmic structure with the diameter of 10 nm. These…
Q: Peptidyl transferase activity (peptide bond enzyme activity) is associated with what site in the…
A: The translation is a process through which the polypeptide chain is synthesized based on the…
Q: Locard’s exchange principle states that, whenever two objects come into contact with one another,…
A: The Locard's Exchange Principle states that " every contact leaves a trace" therefore during the…
Q: QUESTION 14 (1) In action potential's all-or-none law, a sub-threshold depolarization won't trigger…
A: Sub-threshold is a very low magnitude stimulus that is not enough to produce an action potential in…
Question 25
Step by step
Solved in 2 steps
- QUESTION 4 Short tandem repeats (STR) profiling is based on O A the fact that many foods are being genetically modified and this test allows food health officials to identify the transgenic ones. OB. the fact that you can clone mammals through fusion of one somatic (non-sex) cell with an egg cell whose nucleus has been removed the fact that one strand of DNA can be turned into millions of identical copies by a process that heats and cools DNA and builds it using DNA OC. polymerase and primers. the fact that people's DNA is filled with short sequences, like "TCAT" that are found in different numbers in each person. OD.QUESTION 10 Remdesivir is converted in vivo to CMP analog and then phosphorylated to CTP analog. a successful treatment for Ebola. There are more than 1 correct answers in the other choices. a potential chain terminator for the replication of RNA viral genomeQUESTION 4 DOK 1 3. Click and drag the 'Positive Transcription Factor' to the dotted region that appears in Gene 1. 4. Now drag the floating 'RNA Polymerase' back to Gene 1. What molecule is produced? SELECT AN ANSWER MRNA Ribosome Protein RNA polymerase SUBMIT 7:32 PM Ca ENG 3/24/2021
- Question 16 The full set of different transcripts expressed by a cell is called Question 16 options: Proteome Genome Transcriptome Glycome Question 17 One of the major drawback of using Microarray over RNA sequencing for high throughput sequence analysis is Question 17 options: allows quantification of transcripts over five orders of magnitude used to identify new transcripts and alternative isoforms RNA-Seq is sensitive and offers a way of profiling transcripts of single cells a significant amount of input RNA is required Question 18 Which of these statements are not true for the DNA libraries: Question 18 options: Genomic DNA libraries are collection of cloned DNA fragments representing the genome from an organism. Genomic DNA is completely (fully) digested with…Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCGATATAAGTGCACCATGCGAT 5' Start site Short Answer 140QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…
- QUESTION 4 Short tandem repeats (STR) profiling is based on O A. the fact that many foods are being genetically modified and this test allows food health officials to identify the transgenic ones. O B. the fact that you can clone mammals through fusion of one somatic (non-sex) cell with an egg cell whose nucleus has been removed oc the fact that one strand of DNA can be turned into millions of identical copies by a process that heats and cools DNA and builds it using DNA polymerase and primers. the fact that people's DNA is filled with short sequences, like "TCAT" that are found in different numbers in each person. OD.Question Completion Status: A Moving to another question will save this response. Question 11 "If a DNA molecule has 12% thymine, how much guanine will it have?" 12% 24% 38% 76% A Moving to another question will save this response. MAR 16 étvQUESTION 1 The table below shows the results from looking at the diagnostic accuracy of a new rapid antigen test for COVID-19 in 100000 patients, compared to the reference standard RT-PCR test. The rows of the table represent the test result and the columns the true disease status (as confirmed by RT-PCR). COVID-19 Positive COVID-19 Negative Antigen Test Positive Antigen Test Negative 424 795 8216 90565 Calculate the SENSITIVITY of this new rapid antigen test as percentage with 3 decimal places. (Assume that the RT-PCR reference has a 100% Sensitivity and 100% Specificity.)
- QUESTION 23 Michelle has a clone of the DNA of a newly discovered virus. She wants to identify which specific cells of an organ are infected by the virus. What method would be the most useful to answer this question? O restriction fragment analysis O microinjection of the gene fragment O Sanger sequencing of the clone O FISH (fluorescent in situ hybridization) O real time PCR QUESTION 24 Mutagens are useful in biotechnology research for Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All AnsweQuestion 15 Genomic annotation O requires STSS identifies the location and function of genes Oboth a and b none of the above. A Moving to another question will save this response. Mac 0000Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCATGCGAT 5' Start site Short Answer