QUESTION 24 Answer Assume that a given plasmid vector to be used in a cloning experiment contains 4000 base pairs of DNA. Assume also that the restriction endonuclease Cul cuts this plasmid at the following sites (starting from an arbitrary zero point): 1000, 1500, and 3000 Given complete digestion of the plasmid with the endonuclease so that only linear fragments are produced, what sizes of DNA are expected? (Hint: drow the picture of plasmid and mark restriction points on it)

QUESTION 24 Answer Assume that a given plasmid vector to be used in a cloning experiment contains 4000 base pairs of DNA. Assume also that the restriction endonuclease Cul cuts this plasmid at the following sites (starting from an arbitrary zero point): 1000, 1500, and 3000 Given complete digestion of the plasmid with the endonuclease so that only linear fragments are produced, what sizes of DNA are expected? (Hint: drow the picture of plasmid and mark restriction points on it)

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

What are best examples for a cancer program planning component by using a logic model
function of JAK1 gene
One gene (segment of DNA) codes for one ______ One mRNA codon codes for one _______
The attenuator is an important regulatory sequence that influence gene expression. The attenuator is located within a region called the ______________________________.
BL1250 Group activity 4 2020 (1) – Saved to my Mac v Mailings Review View Tell me EXERCISE 4 QUESTIONS 1. TRANSCRIPTION: Much research effort has been invested in understanding how transcription is regulated, because this process is very important for determining cell function. Transcription is a major on/ off switch for genes, providing the instructions for translation and determining the types and amounts of proteins made in a cell at a specific time. The Zebrafish is a model organism for research, and many biologists study how the regulation of genes affects the development of the zebrafish embryo. The effects of a variety of experimental conditions on zebrafish embryos can be easily visualized by light microscopy, because the outer covering (chorion) and the embryo are both transparent. See an images of zebrafish embryos at different time points in development and the adult form below. 0h Os 0.75 h 2h 3.25 h 8 h 16 h 24 h 72 h Adult -3 months (not to scale) Image from:…
Sigma-32 is probably an autoregulator. Why and how?
cggcaggagc cccccgacct cccaggcgga ccgccctccc tccccgcgcg cgggttccgg gcccggcgag agggcgcgag cacagccgag gccatggagg tgacggcgga ccagccgcgctgggtgagcc accaccaccc cgccgtgctc aacgggcagc acccggacac gggcctcagcc actcctacat ggacgcggcg cagtacccgc tgccggagga ggtggatgtg ctttttaaca tcgacggtca aggcaaccac gtcccgccct actacggaaa ctcggtcagg Provide the primers for the nucleotide sequence above (GATA3)gene
Briefly explain why each of the following statements is false, or reword it to make it true5. Each gene codes for just one protein.
Translating mRNA C G A A U G C C G U A U U C G to amino acids
If you are a genetic engineering. Will you transfer horseshoe crab's blood into what animal. Provide your reasons.
In mRNA, thymine is replaced by the nitrogenous base______
where did the GTP come from?