Question 11 Chordates typically have O a notochord. O radialcleavage. All of the choices are typical chordate features. O a coelom that iseither enterocoelous or schizocoelous. O the anus derivedfrom the blastopore.

Q: Question:Muscle or muscles that answers the question:If the triceps brachii is a prime mover of…

A: Antagonist is a muscle with the opposite action of the prime mover. There are two important…

Q: Rotator Cuff Muscle Action   Supraspinatus     Infraspinatus     Teres minor…

A: The shoulders in the chest, back, and upper arms are moved by the muscles. The scapula and humerus…

Q: MARK and Identify the insertion of the Extensor carpi ulnaris on the image below

A: Extensor carpi ulnaris It is defined as a fusiform muscle that is present in the posterior forearm.…

Q: QUESTION 9 Identify the insertion of the Extensor carpi radialis longus on the image below…

A: The soft tissue in mammals is muscle. The muscle cells possess protein filaments, namely, myosin and…

Q: 61. Identify the muscle indicated by tag #61. 61 61

A: Pulmonary means relating to the lungs or lung tissue. Pulmonary ventilation is also called as…

Q: A B F L D E I G H J K L M N (a) Sagittal section through the right knee joint

A: Joints are the structure in which two bones are connected with each other . Joints are classified…

Q: If a muscle has the word hallucis in its name, it must cause movement of the -…

A: Muscles are the part of skeletal system in animals and humans. Muscle tissue is made up of Myocytes…

Q: 67. Identify the three muscles that share the origin indicated by tag #67. Be specific 67

A: Hip Bone  It is formed by the attachment of 3 bones -  Ilium  Ischium  Pubis  It is also termed as…

Q: Stem cell for Rheumatoid arthritis treatment Mesenchymal Stem/Stromal Cells for Rheumatoid Arthritis…

A: Introduction  The autoimmune illness rheumatoid arthritis (RA) affects the joints, producing…

Q: Sequence A uuucccucuuagaauuaauucguaauauuuaucau uuaaauuuagcucccuccccccauuaauaaauaauu…

A: RNA molecules are formed with the help of template DNA strand in the process transcription with the…

Q: Why is it more difficult for Eric to lift a heavy weight when hisforearm is pronated than when it is…

A: The up and down orientation of the body parts such as hand, arm and foot are mentioned with the…

Q: 62. Identify the muscle indicated by tag #62. 63. Identify the muscle indicated by tag #63. 64.…

A: 62.  Figure is Medial view lower limb showing medial thigh muscles . Muscle indicated by #62 :…

Q: QUESTION 15 Identify the origin of the highlighted muscle: A. Head and shaft of Fibula and Posterior…

A: Legs generally have long muscles. The muscles in the leg are highly stretchable. The contraction and…

Q: Which number is triceps brachii

A: Locomotion and movement of our body are carried out with the help of muscles and bones. Muscles…

Q: MARK and Identify the origin of the Extensor carpi ulnaris on the image below

A: Extensor carpi ulnaris It is defined as a fusiform muscle that is present in the posterior forearm.…

Q: What is the neuromuscularsynapse?

A: The neuromuscular junction is a site where, the axons and the muscle fibers communicate with each…

Q: 59. Identify the muscle indicated by tag #59. 60. Identify two action(s) of the muscle indicated by…

A: Muscles are the soft tissue present in many animals. It consists myosin and actin protein filaments…

Q: If a prime mover muscle such as the pectoralis major is surgically removed, how will the actions…

A: Pectoralis major is a muscle located at the chest of the body of humans. It is a fan-shaped thick…

Q: quizzes/47131/take uestion 10 synergist muscle always aids the antagonist O True O False uestion 11

A: Movement by the body parts is made by the muscles present in them. In an alternating contraction…

Q: The _________________________________________ muscle spans from the ribs and sternum to the pubic…

A: The abdominal wall surrounds the abdominal depression, giving it adaptable inclusion and ensuring…

Q: can someone help me identify what each of the numbers are labeled as? specifically anything that is…

A: "The description portion has been omitted since it would be impossible to adequately describe all…

Q: The inner thigh relative to the outer thigh would be:

A: The thigh bears much of the load of the body’s weight when a person is upright. It contains many…

Q: Inside view of edge. Note hacklemarks.

A: Tissue Response to Mechanical Stress1. Microtrauma and Microfractures:• Similar to hackle marks in…

Q: A С B D

A: The skeletal muscles are the type of muscles that are attached to the bone; when they contract, they…

Q: 49. Identify the muscle indicated by tag #49. 50. Identify the three actions of the muscle indicated…

A: The pectoral region is located on the anterior chest wall.  Four muscles are present on the anterior…

Q: The pectoralis minor is labeled B. C A D E

A: The given image shows the ventral muscles of the upper body. The pectoralis minor muscle is one of…

Q: Describe the condition frozen shoulder

A: Synovial joints join the bones with a joint capsule, and the joint cavity is filled with synovial…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.