Question #1: Please describe the specific enzymes that you are familiar with that are involved in the catabolizing of carbohydrates, lipids, protein, and nucleic acids. At what pH are these optimized?
Q: Question 10 Hormones, such as testosterone, estradiol and progesterone are examples of steroidal…
A: Hormones, such as testosterone, estradiol and progesterone are examples of steroidal lipids. True OR…
Q: Look at tho structuros of tho blood group dotorminante. Red blood cell N-Acetyl- D-glucosamine Blood…
A: Blood group antigens are O-glycoproteins, N-glycoproteins, and glycolipids that are present on the…
Q: Gluconeogenesis in the liver is When blood glucose levels are low, glucagon is secreted from the…
A: Blood is defined as the type of constant circulating fluid that play a major role in carrying…
Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…
A: The Molisch's test, Fehling's test, and Bial's test are the qualitative tests for carbohydrates. In…
Q: Which of the following substances ATP, CoA-SH, FAD and NAD+ have the subunits in their structure?…
A: FAD/FADH2, NAD+/NADH, and NADP+/NADPH are cellular electron carriers and ATP is the energy currency…
Q: Describe the basic chemical requirements for the aminoglycosides. Why are these compounds strongly…
A: A base can accept the protons from the solution and can exist as a cation. An acid can donate its…
Q: You receive a tube containing 18.8 nmol of lyophilized (freeze dried) primers to be used in PCR. How…
A: Primers are a short nucleic acid sequence that provides a starting point for DNA synthesis. I…
Q: please name and characterize the enzym class according to the given rraction C=O 0. CH ČH-OH C=O Ó.…
A: The given molecule is fructose-1,6-bisphosphate which is broken down to glyceraldehyde-3-phosphate…
Q: Question 5 In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B A.
A: Cell membrane is made up of lipid bilayer. The composition of different types of lipids has very…
Q: Which pair of bases is linked together by two hydrogen bonds? Group of answer choices guanine and…
A: Purines pairs with pyrimidines via formation of H-bonds. Purine: Adenine, Guanine Pyrimidine:…
Q: calculate the net charge of your peptide at I) pH 2.0; ii) pH 6.0 iii) pH 7.0; iv) pH 11.5. show…
A: Amino acids contain ionizable groups, the ionic form of the amino acids depends on the pH. The…
Q: In the structure of vancomycin, what moiety contributes to its solubility in polar medium?
A: Vancomycin is a glycopeptide antibiotic and kills gram-positive bacteria such as…
Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…
A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…
Q: 4. During a lunch at a MeDonald's outlet, an office employee received about 350 g of carbohydrates…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: What is unique about the use of viral gene therapy in cancer immunotherapy
A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…
Q: 6. An organic substance bound to an enzyme and essential for its cavity is called: a. Coenzyme b.…
A: The non-protein factors that are necessary for activity of some enzymes are called cofactors.
Q: All are members of the electron transport chain, except: Select one: O a. iron-sulfur center O b.…
A: The components of the Electron Transport Chain (ETC) are found in the mitochondria. During…
Q: Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: 6. Describe the salient features and functions of phospholipids
A: Phospholipids or phosphatides are molecules which belong to the class of lipids has hydrophilic…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: 2. Biosynthesis of thyroid hormones. Proteins: A. Thyroglobulin with DIT. B. Thyroglobulin with T C.…
A: As shown in the given figure, thyroid hormone synthesis occurs in following steps: iodide (I-)…
Q: Which of the following products of the non-oxidative stage of PPP is an intermediate of the…
A: The hexose monophosphate shunt, also known as the pentose phosphate pathway, is a shunt from…
Q: How many more acetyl CoA are generated from stearic acid than from linoleic acid during beta…
A: The process of beta oxidation of stearic acid yields two distinct products and these are acetyl-CoA…
Q: Visceral fat loss is often associated with increased insulin sensitivity. Assuming that with the…
A: D. -10.6
Q: Which pathway uses glucose 6-phosphate to produce NADPH, ribose 5-phosphate, and other sugar…
A: Major metabolic pathways of carbohydrates are glycolysis, TCA cycle, gluconeogenesis, glycogenesis,…
Q: H o-H H Н-С-н `cc- .と、 H toluene phenol エ エ 工王 \\
A: Retention factor The amount which each component of a mixture travels can be easily quantified using…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: The solubility of a protein in solution depends on nature of the protein and the concentration of…
Q: Outline 3 properties of proteins that can be used in bioseparations and explain how you could…
A: Proteins are macromolecules that are made up of Amino acids. They can be classified as globular…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: 3. A 2-year-old child was taken to the hospital. His mother said that he vomited frequently,…
A: Mutations in enzymes of the metabolic pathways are called inborn errors in metabolism.
Q: What is the heterozygous advantage of people having sickle-cell trait in areas where malaria is a…
A: Introduction: Sickle cell anemia is an autosomal inherited blood disorder that affects hemoglobin…
Q: Three sugars (Sugar A, Band C) were applied to a line as part of the set-up of a Paper…
A: Paper chromatography is the basic technique to separate dissolved chemical substances from the…
Q: POST-LAB QUESTIONS 1. When a reducing sugar reacts with Benedict reagent, what organic product is…
A: 1. The Benedicts reaction with reducing sugar is given below. Reducing sugars can be either in…
Q: of Mg2+.Classify each analyte based on its level in the soil sample
A: Amount of soil sample = 2.65g In mg = 2.65 × 1000 = 2650…
Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…
A: Bioremediation is a waste management technique. Living organisms can be used in this process to…
Q: In which of the following processes is glucose 6-phosphate the end product? Group of answer…
A: Glucose : Carbohydrate that serves as the major energy source for the body. Glucose-6-phosphate:…
Q: The polypeptide chains in insulin are held together by hydrogen bonds Group of answer choices True…
A: Insulin is a protein made up of two polypeptide chains designated as A (21 amino acids residues) and…
Q: True or False? a. An excess of amino acids can result to the destruction of proteins.
A: The destruction of proteins in cells can occur when due to misfolding and aggregation of proteins…
Q: HN- CH- OH HN-CH-c- -OH HN-CH-C-OH CH CH2 CH2 CH2 OH C= NH2 OH A B D C.
A: Amino acids are those molecules which combine to form particular proteins. Amino acids and proteins…
Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…
A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…
Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…
A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…
Q: Identify the mRNA codons that could have been used in the protein synthesis process to convert DNA…
A: mRNA is the product of transcription formed from DNA by RNA polymerase. This mRNA is important for…
Q: Introduction to urinary proteins and CSF proteins.
A: Protein is a highly complex molecule found in all living things. Proteins were identified as…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: What is substrate-level phosphorylation? 2. Although oxygen does not participate directly in the…
A: ATP is the energy currency of the cell and is praoduct of catabolic pathways that is used in…
Q: Which statement is correct about expression of a gene regulated by Gal4? O Galactose increases gene…
A: In yeast the transcriptional activator GAL4 binds to the upstream activating sequence of the gal…
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Hi! Thank you for the question. We are authorized to answer one question at a time, since you have…
Q: What enzyme is the point of regulation for fatty acid synthesis in the cytoplasm? Fatty acid…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: i need the answer quickly
A: Vitamin B6 aids in the maintenance of a healthy level of this amino acid in the blood. A more…
Step by step
Solved in 3 steps
- The purpose of this experiment is to determine how the activity of an enzyme can change under certain conditions: temperature, pH, substrate concentration Introduction Purpose statement is specific, complete and uses proper scientific vocabulary Hypothesis statement is clear, logical and scientifically sound Contains sufficient background information relevant to the lab Accurate use of examples and scientific terminology Clear, concise (max 1 page; single spaced) Step 1: Obtain a sample amount of a hard fruit or vegetable, such as an apple, cut it into smaller equal pieces, and measure on a digital scale of 10g. Step 2: Get 100ml of room temperature tap water and add it into a glass cup, heat it on a hot plate until reaches 37 Celsius Step 3: Add the apple sample into the glass cup with the tap water and mix gently. Let the mixture to sit for 5 minutes. Step 4: With a kitchen thermometer measure the temperature of the apple mixture. Step 5: In a glass cup add 3mL of 3% hydrogen…Beadle and Tatum proposed the one gene-one enzyme concept - This hypothesis can now be restated in which of the following ways? A given sequence of DNA nucleotides contains information to make one enzyme Each gene contains information to make one protein, one lipid and one carbohydrate Each gene is actually an enzyme that catalyzes the production of one protein Each polypeptide is the result of the activity of one enzymeThere may be more than correct answer for each Which of the following statements regarding enzymes are correct? a.) Enzymes lower activation energy b.) Enzymes are synthesized in the mitochondria c.) Enzymes show a high degree of specificity for substrates. d.) Enzymes stabilize intermediates The ability of DNA to denature is important for which of the following processes? a.) DNA synthesis b.) nucleic acid hybridization experiments c.) RNA synthesis d.) formation of biomembranes
- Please answer both questions: a) If we get 36 ATPs in the complete oxidation of one molecule of glucose, how many amino acid residues can be incorporated to a growing polypeptide chain using the energy derived from glucose. Show how you arrived at your answer. b) All polypeptide synthesis starts with the codon AUG bringing methionine at the very first position at the N terminal but, examination of many biological and functional proteins in the cell, when sequenced, does not reveal the presence of methionine at the very first position at the N-terminal. Why and how could this be possible? Explain.Miller-Urey type experiments have shown that simple organic molecules like amino acids can be produced from inorganic material. While this offers a first step in explaining how life came to be, it does not explain how complex life came to be. It is thought that RNA may have played an important role in transitioning from a world without life to a world with cells, particularly because of RNA’s ability to form ribozymes. Why are ribozymes important? Ribozymes are able to build DNA. Ribozymes can be held inside a vesicle. Ribozymes are able to catalyze reactions and replicate themselves. Ribozymes are the simplest macromolecules able to contain genetic information.Write if the statement is true and change the underlined word if false. The Miller-Urey experiment served as a simple experiment on how biomolecules likely to have formed on early earth. Eukaryotes contain mitochondria. Stomata are the sites of photosynthesis in green plants and algae. Proteins are the most important final products of the information pathways. Proline is an example of secondary amino acid. Histidine contains an imidazole ring. The side chains of asparagine and glutamine are uncharged and highly polar. Hydroxproline is a non-standard amino acid that is produced in the thyroid glands. The linear sequence of amino acids in a polypeptide chain is called the primary structure of a protein. A peptide bond is an examples of amine linkage. The peptide group is tetrahedral as a result of resonance stabilization.
- The One Gene One Enzyme Hypothesis (Beadle and Tatum, 1941) stated that each gene codes for a single enzyme. Summarize the advancements that have made the One Gene One Enzyme Hypothesis obsolete.Explain in detail the steps involved in the Central Dogma, including these details and concepts: location in the cell or organelle where the processes occur, the main enzymes and substrates for each process in the Central Dogma, details about initiation, elongation, and termination of each process in the Central Dogma.Suppose in your biochemistry class you are given an enzyme and you are asked to determine whether egg or the starch is the substrate for this enzyme. Arrange the following statements such that it explains how you would go about doing this task from first step to the last step (you can drag and drop the choices to arrange from the first step to the last step): Drag and drop options into correct order and submit. For keyboard navigation. SHOW MORE V First take three test tubes labeled as A / B and C. A is the negative control and just add buffer. To the test-tube B add 5ml of raw egg in buffer. To tube C add 5 ml of starch solution in buffer After 30 minutes of incubation - take the three tubes out and divide the content of each tube into to two tubes. So you will now have total of 6 tubes - two for control - two 'B' tubes and two 'C' tubes First you will test to determine if the substrate is egg : To one set of tubes A/B and Cadd ninhydrine - appearance of = blue or brown or yellow…
- When energy is absorbed by a molecule, it can trap some of the energy within the molecule by altering its structure. Therefore, in some cases there has been evolutionary development of enzymatic activity that can return the molecules to their original, functional states. On the other hand, in other cases the absorption of energy may be so great that no reversion to the original state can occur Which one of the following is example to this (no reversion is possible)? Select one: a.Conversion of 11-cis form of retinal to the all-trans form of retinal upon exposure to light, with a maximum abspance at 500 nm. b. Thymine-thymine and thymine-cytosine pyrimidine bridges formation upon exposure of DNA to UV-B radiation. c. The absorbance of radiant energy by Melanın pıgment in the skin. d. The translucent to opaque converSion of egg whites when cooked by increasıng the temperature.Is the data that you are collecting in the above table quantitative or qualitative? Explain why. Which treatment had the least amount of browning? Which had the most? Why do you think you obtained these results? Remember that the enzyme polyphenol oxidase is a protein! For each treatment, apply your knowledge of how temperature, pH, and salt concentration affect enzyme activity and explain why you got the results that you did. Include bonds and the levels of protein structure that you explored in Activity A in your answer. How does temperature impact the rate of enzyme activity? If you were to leave the apple in the refrigerator longer, why would it eventually brown? Explain based on what you know about enzyme activity. How does pH and its impact on specific types of bonds explain the results you obtained in your lemon juice treatment? Include bonds and levels of protein structure in your answer. How does salt and its impact on specific types of bonds explain the results you obtained…Most enzymes are quite specific, catalyzing a particular reaction on a set of substrates that are structurally quite similar to one another. Why are highly specific enzymes advantageous from a biological perspective? They allow catalyzed reactions to produce potentially useful by-products. They allow for the sharing of enzymes by multiple metabolic pathways. They allow an inhibitor to simultaneously inhibit multiple steps in a metabolic pathway. They allow control of which reactions occur at appreciable rates. Why are most enzymes highly specific from a chemical perspective? Enzymes generally requires a tight fit between enzyme and substrate. Interactions between the enzyme and the substrate stabilize the substrate. The active sites of enzymes are always identical in shape to the substrates they bind. The formation of weak interactions between the enzyme and the substrate requires energy.