Q10 The ph values of two and 6. Indicate which and how more acidic 3 Tiquid is much more.

Q: Which structure is NOT present in DNA? * (1 Point) A в D E NH2 NH2 H3C. NH2 B.

A: Option d ( Tryosine has aromatic group)

Q: com X The folding of a protein is a complex and random process. Real Fake ê Abrir en Google…

A: A) Real    The folding of a protein is a complex and random process

Q: QUESTION 55 The likelihood that the longer elution times (Rf) were due to the following: O The more…

A: As per our guidelines, I can answer only first question. Because you have posted multiple questions.…

Q: Define captopril ?

A: Captopril is a drug used to treat high blood pressure and congestive heart failure. Its IUPAC name…

Q: Q1) Define terms polymers, elastomers, and synthetic fiber. Also explain in detail the industries…

A: Solution - Polymers - A polymer is  class of natural or synthetic substances which is  made up of…

Q: Draw the structures of the products formed by hydrolysis of the following tripeptide at…

A: For the given tripeptide Gln-Val-Ser (glutamine-valine-serine) hydrolyzed at physiological pH, the…

Q: Select the incorrect statement from the following option. A) Oils are saturated triglyceride B…

A: Saturated CompoundCompound contains only single bonds.Unsaturated CompoundCompound contains at least…

Q: What structural features make polymer to be thermo and thermosetting polymers? Explain with one…

A:

Q: Most ring fusions in a steroid molecule are: Cis Parallel Trans Anti

A: Steroid molecules generally have a four fused cycloalkane rings. For example cholesterol.

Q: Consider the tripeptide phenylalanylcysteylmethionine. Part: 0/2 Part 1 of 2 Draw the structure of…

A: Peptide structures are written in such a way that left side is N-terminal while right side is…

Q: In polarimetry when lactic acid measured was contaminated with glycerol, what happens to the…

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: The predominant noncovalent interaction involving the polypeptide backbones of a- helices and…

A: Proteins, the molecular workhorses of living organisms, owe their functionality to their intricate…

Q: 1. Draw 2D chemical representations of atactic, syndiotactic, and isotactic polystyrene. 2.…

A: First  three question answered below:

Q: what is electrical double layer ? how it is formed ? how many types of micelles ate there give their…

A: In this answer, we will be discussing the concept of the electrical double layer, which refers to…

Q: Is there commerical resin similar to RP-46 polyimide resin?

A: Ans:  widely used thermoset polyimide resin comprises PMR-15 and RP-46

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: At what pH will the following tripeptide have this structure? H2N-CH- -CH-C- N-CH-C-OH CH2 CH-OH CH2…

A:

Q: acid) of the polymeric chains to produce large and narrow size porous structure, respectively.

A:

Q: (k) dendrimer (1) engineering plastic (m) elastomer (n) end group (o) graft copolymer

A: A polymer is a large molecule composed of repeating units called monomers.

Q: How does polyimides behave in acidic media?

A: The polymer of the imide monomers that belongs to class of the high performance plastics are known…

Q: How many fused rings are there in steriod?

A:

Q: Demonstration: the specimens shown are (a) a piece of cured epoxy resin, (b) a rubber band, and (c)…

A: Thermosets are polymers in which a cross-linking reaction which occurs. It promotes the chemical…

Q: 1. Draw three molecules of ZX3 in the liquid state. In your drawing, indicate (with an arrow) and…

A: Structures of the given molecular formula:

Q: A processed lemon juice is stored at 4 oC and 10 oC in order to compare storage stability. For…

A:

Q: 2. a. Which amino acid is this? (might need to look at another amino acid b. Label which of these is…

A:

Q: n one. Match enzyme or molecule with its function in bacteria. Answers may be used more than once or…

A: 37. RNA polymerase is the main enzyme in catalyzing DNA→ mRNA transcription.  38. DNA helicase…

Q: Shouldn't it be.... AI2Se3?

A: The compound Aluminium Selenide is made from elements Aluminium and Selenium

Q: Sketch the structure of a tripeptide composed of D-glucose, D-mannose, and D-galactose (in that…

A: Tripeptide are essentially consists of three amino acids which are linked together by forming to…

Q: A. Circle the peptide bond in this structure. H3N CH- - ܬܐܐܐ || - H N-CH-C-0 CH3

A: A peptide bond, also referred to as an amide bond, is formed between the α-nitrogen atom of one…

Q: Hyaluronate in the cartilage acts as a: repeating unit of the aggrecan molecule. central filament…

A: Hyaluronate in the cartilage acts as a central filament between  glycosaminoglycans It is present…

Q: β-sheets form due to hydrogen bonding between ________, and parallel β-sheets are held together with…

A: Beta sheets are the secondary structure of protein.

Q: Why can't chemical recycling–that is, the conversion of polymer to monomers and reconversion of…

A: In the preparation of low density polythene, very high pressure is required which is around 1000 to…

Q: Discuss the potential impact of polymorphism on the physicochemical properties of drugs.

A: The potential impact of polymorphism on the physicochemical properties of drugs are

Q: Provides the missing structures Br₂/FeBr3 A CH3CH₂CI AICI3 B

A:

Q: Which of the following substances meets the definition of a pure "compound" according to the…

A:

Ionic Equilibrium

Chemical equilibrium and ionic equilibrium are two major concepts in chemistry. Ionic equilibrium deals with the equilibrium involved in an ionization process while chemical equilibrium deals with the equilibrium during a chemical change. Ionic equilibrium is established between the ions and unionized species in a system. Understanding the concept of ionic equilibrium is very important to answer the questions related to certain chemical reactions in chemistry.

Arrhenius Acid

Arrhenius acid act as a good electrolyte as it dissociates to its respective ions in the aqueous solutions. Keeping it similar to the general acid properties, Arrhenius acid also neutralizes bases and turns litmus paper into red. 

Bronsted Lowry Base In Inorganic Chemistry

Bronsted-Lowry base in inorganic chemistry is any chemical substance that can accept a proton from the other chemical substance it is reacting with.