Proteins can be glycosylated (have sugar molecules added to them) through the formation of either acetals/ketals or Schiff bases. Which amino acids have side chains that can be used as reactants to form acetals/ketals or Schiff bases? Drag the appropriate amino acids to their respective bins. Ser Submit Arg Gly Tyr Thr Lys His Acetal/ketal Request Answer Schiff base Reset Pro Trp Val Neither Help

Q: Reaction centers PSI and PSII are also called as per the wavelengths at which they have a maximum…

A: Photosynthesis is the process by which plants, algae, and some bacteria convert light energy into…

Q: Two of the body’s important fluid compartments are those of the interstitial fluid and plasma. How…

A: The liver produces and secretes major plasma proteins, factors in homeostasis and fibrinolysis…

Q: Name the class.

A: In a biological hierarchy, the class is a taxonomic level; that is, it is a taxonomic unit in that…

Q: How many g of NaCl are in 2.5L of D50WNSS?

A: Drug calculation is an essential part of medication administration among nurses .As Nurses, we need…

Q: Describe how you would make 10mls of a solution with concentration: 10mM Glucose (MW-180.16g/mole)…

A: In a solution concentration of solute is reduced simply by mixing more water or by adding more…

Q: 6) The order is for amoxicillin 500 mg PO. You have on hand a 150-mL bottle of dry powder. The…

A: In this question we will ist calculate the concentration of Amoxicillin in 1 ml of the solution and…

Q: 9) Label highlighted nerve in the box 10) This nerve belongs to the

A: The given diagram shows an image of the hip region and the highlighted nerve which exits from the…

Q: 9:58 ← LTE 43% PHGY 215 Applied Physi... Questions: 1. Using Table 3, which contains the normal…

A:

Q: Enalaprilat is a competitive inhibitor of the angiotensin-converting enzyme (ACE), which cleaves the…

A: Here, ACE is the enzyme, angiotensin I is the substrate and enalaprilat is the inhibitor.Given…

Q: Define Bohr effect

A: In human physiology, the Bohr effect refers to the phenomenon that describes hemoglobin's function.…

Q: Suggest the most appropriate organic/aqueous medium for use in determining P values in the following…

A: Partition coefficients (P values) are vital in understanding how a medication or chemical carries on…

Q: Is vitamin c portly soluble of immediate solubility or highly soluble and what are the mol 1-1

A: Vitamins are small molecule which are required for normal functioning of the body. These molecules…

Q: CH-CH NH C-NHCH 林 H3C HN A B C D Look at chemical structure and chose true chemical group added to…

A: Histamine is an immunomodulatory compound. Some of the immune responses such as inflammation and…

Q: (c) Discuss the mechanism of action of the enzyme chymotrypsin.

A: Chymotrypsin is a protease enzyme that aids in the digestion of proteins. Chymotrypsin is a protein…

Q: Define iodide pump.

A: Iodide pump : An integral membrane protein that co transports Na+ and I- into the thyroid follicles.…

Q: Why is important to determine both the absorption spectrum and the action spectrum?

A: An absorption spectrum is a spectrum of electromagnetic radiant energy whose intensity at each…

Q: What are cardiac glycosides? How do cardiac glycosides function?

A: Glycosides are biomolecules in which sugar is bound to other functional group through glycosidic…

Q: - For a solution in which u = 8.0 X 10 2, calculate K, for %3D

A:

Q: Describe Bohr effect and give its physiological significance

A: Hemoglobin is present in the RBCs of humans and acts as a carrier for the oxygen gas in living…

Q: explain bohr shift?

A: Hemoglobin is a tetrameric protein that transports oxygen in the blood. The affinity of Hb for…

Q: Wall Chemistry Matching: Match each of the following with the appropriate chemical (unless otherwise…

A: Cellulose is a polysaccharide composed of repeating glucose units linked by β-1,4-glycosidic bonds,…

Q: The following lipids contain sphingosine as the alcohol backbone EXCEPT O Cerebroside O Ganglioside…

A: Sphingosine is composed of  an amino alcohol head group, with two hydroxyls, and one amino group…

Q: (i) (iv) 3.0 2.5 2.0 1.5 1.0 0.5 0.3 (ii) (iii) Air 20°C 101525Pa Limin

A: Bioreactor: It consist of a vessel where biological reactions takes place through the transformation…

Q: How do the changes in structure, polarity and functional groups affect the movement of diazepam…

A:

Q: Explain Digoxin ?

A: Digoxin belongs to a category of medications referred to as cardiac glycosides.

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Describe Poiseuille’s law?

A: Non ideal fluid dynamics is defined as a branch of fluid dynamics where it helps in understanding…

Q: What is absolute configuration of L-threonine?

A: Absolute configuration depicts the relative orientation of groups around chiral carbons. Absolute…

Q: How many g of dextrose are in 3 L of D5W

A: Dextrose is a simple sugar. it is made from substance chemically identical to glucose.   it is used…

Q: Clare Boothe Luce, ambassador to Italy in the 1950s (and Connecticut congressperson, playwright,…

A: Introduction: Cupric arsenite is a carcinogen known to cause cancer in humans along with other…

Q: Why is picric acid used for burns? Explain the principle involved

A: Cells are the basis of life. Cells give rise to tissues and organs. Organs that work towards the…

Q: Which of these compounds may be a part of cell membranes: triglycerides, phosphatidylcholine,…

A: Cell membrane is the envelope that surrounds the cytoplasm. It provides shape and structure to the…

Q: What is Allen’s rule?

A: Animals are multicellular eukaryotic organisms that form the biological kingdom Animalia. With few…

Q: What is the chemical basis for ethanol’s solubility in blood?

A: Ethanol is an organic chemical compound. It is a simple alcohol with the chemical formula C. Its…

Q: Name the following fatty acids by the symbol (C:B)

A: A carboxylic acid with an aliphatic chain, whether saturated or unsaturated, is referred to as a…