Our species, H. sapiens, derived from:OH. floresiensis.●H. ergaster.O H. habilis.OH. rudolfensis.OCTtv8ЛАW91

There are different species of homo which are considered to be the common ancestor of modern man.…

Answered: Our species, H. sapiens, derived from:…

Science

Biology

Our species, H. sapiens, derived from: H. floresiensis. H. ergaster. H. habilis. OH. rudolfensis.

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter1: The Science Of Biology

Section: Chapter Questions

Problem 3CT: Why would you think twice about ordering from a restaurant menu that lists the specific epithet but...

See similar textbooks

Related questions

Q: What is a common trigger for the bacterial SOS response? A. Thymine starvation B. DNA cross-linking…

A: It is a global response to damage of DNA by bacteria. It causes the induction of mutagenesis and DNA…

Q: Draw a diagram/graph to represent the results of an experiment that would prove that there was…

A: Horizontal gene transfer is a method of gene transfer between two unrelated species. Here a…

Q: Question 1 of 5 Label the phylogeny by selecting a species from the Answer Bank to depict the…

A: In taxonomy the construction of phylogenetic tree is very important that gives us an idea about the…

Q: You are a microbiologist, you were using spread plate counts to quantify the effects of a new…

A: The spread plate count is a microbiological technique used to determine the concentration of…

Q: genes, gene density, and number of exons. Prokaryote one gene every 2000 to 100000 bp mly large,…

A: Prokaryotes are the microorganisms which are usually unicellular and they are devoid of any membrane…

Q: el Which of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on…

A: Bacteria are relatively simple, microscopic and prokaryotic organisms which lack nucleus and other…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: A pathogen is a microorganism, such as a bacterium, virus, or fungus, that can cause diseases in…

Q: If interference is complete (i.e., 100% effective), what is the frequency of double crossovers one…

A: Interference is defined as Inhibition of further cross over events by a crossover event in a nearby…

Q: What peptides are expected to be produced when an unknown hormone…

A: Large proteins can be broken down into smaller peptides by using different kinds of treatments like…

Q: You mention is it beneficial to train in high altitudes. Which physiological changes occur in the…

A: It is also known as hypoxic training. It is referred to as training in high altitudes. This can…

Q: Create a visual representation, or a diagram, of the concepts in respiration and photosynthesis. You…

A: Photosynthesis: The process by which green plants produce oxygen and energy in the form of sugar in…

Q: Identify the following (explain in 1-3 sentences): Description: Embryonic origin : Function :…

A: Tissue can be defined as a group of similar cells that usually have a common embryonic origin and…

Q: What do the preceding tests tell you about the case?

A: Based on the above inquiries and responses, the accompanying data has been obtained:The blood sample…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: cross between two heterozygotes fruit flies with purple eyes and white bodies (EeBb) results in 4…

A: Parent 1: EeBbParent 2: EeBbEye color : EeHomozygous dominant (EE): Purple eyesHeterozygous (Ee):…

Q: 1. Draw the label cardiac muscle tissue as you observed it at medium magnification. 2. Draw and…

A: Muscles contract to contribute to both gross and fine movements, enabling actions such as walking,…

Q: Which of the following statements is false concerning the motor protein families of kinesins and…

A: Kinesins and dyneins are molecular motor proteins responsible for intracellular transport in cells.…

Q: Match the items in the left column to the appropriate blanks in the sentences on the right. a higher…

A: The difference in equilibrium constants between fetal hemoglobin (HbF) and adult hemoglobin (HbA)…

Q: Select all CORRECT answer choices for the following statement: "Bacterial populations..." reproduce…

A: Bacterial reproduction refers to the processes by which bacteria, which are single-celled…

Q: AA AS SS otal viduals in these individuals in these individu

A: Population genetics includes the study of genotypic and allelic frequencies within a population.

Q: Indicate whether each of the following statements related is likely to be true or false Similar to…

A: M-cyclin, short for mitotic cyclin, is a protein involved in regulating the cell cycle, particularly…

Q: Answer the following (explain in 1-3 sentences) Description: Embryonic Origin: Function: Location in…

A: Tissue is a group of similar cells that usually have a common embryonic origin and function together…

Q: Select all CORRECT answer choices regarding the following question: "Which of the following are…

A: Bacteria are prokaryotic, single-celled, heterotrophic organisms. As they are heterotrophic…

Q: What behaviors during the egg-laying season might lead to potential behavioral adaptations that…

A: characters During the breeding season,the following behaviors can lead to behavioral changes that…

Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…

A: Evolution is the gradual process through which living organisms change over time, typically due to…

Q: Explain why K+ channels not allow Na+ to pass even though Na+ is a smaller ion, and Na+ and K+ are…

A: Potassium channels are specialized membrane-spanning proteins made up of four subunits that create a…

Q: DNA Typing U S₁ S₂ Locus 1 U S₁ S₂ U S₁ S₂ Locus 1 Locus 2 U S₁ S₂ U S₁ S₂ Locus 2 Locus 3 1. In…

A: A forensic method referred to as DNA typing, commonly referred to as DNA profiling or DNA…

Q: What are the effects of agonists, antagonists, and inhibitors? Which of the types of drug actions…

A: Usually the best target for a drug is a particular type of reaction that is catalyzed by a certain…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: Scientific name (Genus species) - This must be formatted correctly. If your group includes more than…

A: Primates are a diverse order of mammals characterized by features such as forward-facing eyes,…

Q: In Drosophila,, the curled mutation (cu, chromosome 3, position 50.0) results in wings that curl up,…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: How many steps are there in these metabolic pathways? 1. Glycolysis 2. Pyruvate Oxidation 3. Kreb's…

A: Glycolysis consists of 10 steps in total. There are two main phases. Out of the 10 steps, 7 are…

Q: 4. Draw a cell in each of the following phases. Be sure to represent the major events of each phase…

A: Mitosis is the stage of the cell cycle in which newly formed DNA is separated and two new cells with…

Q: Answer the following in terms of genetics: 1. Why is it expected for the larger popualtions to have…

A: Genetic variation refers to the diversity in genetic traits or characteristics within a population…

Q: A type of bird on an island makes nests in both tree roots and in tree branches at various heights…

A: Natural selection is an evolutionary mechanism. Organisms that are better adapted to their…

Q: How many chromosomes are shown in this picture? O 1 1234 O 5 ↑

A: A chromosome is a long, thread-like structure found in the nucleus of a cell. It carries genetic…

Q: Which codons do not have a matching tRNA? Select all that apply O UAA O AUG OUGA UGG OUAG

A: Transfer RNA (tRNA) is defined as a subclass of RNA molecules which is essential for the translation…

Q: A, B, and C are all examples of what general class of biomolecule? Please specify the correct…

A: We are given the image of the cell membrane and we need to identify the biomolecules attached to it.…

Q: Provide details and explain "Epidemic of Absence by Moises Velasquez Manoff microbiome on the gut…

A: Moises Velasquez-Manoff is the author of the book "Epidemic of Absence: A New Way of Understanding…

Q: Draw a model of the plasma membrane to form a cell. Include a tube embedded in the membrane. Show…

A: Plasma membrane surrounds the cell. It is a semi permeable membrane made up of phospholipids and…

Q: What is osteoarthritis

A: The skeletal system is the support system of the body that provides shape and structure to the body.…

Q: DNA Replication and Protein Synthesis Review mmg Template strand SSB B- DNA polymerase Replication…

A: DNA replication is the cellular procedure for making an exact copy of its DNA. It's like making a…

Q: QUESTION 30 Why are model organisms used to test hypotheses? O Human subjects have already been…

A: Answer:- Model organisms play a crucial role in scientific research, particularly in the field of…

Q: Five loci defined by microarrays are known to contribute to meat quality in cattle. Premium meat…

A: You need to determine the possibility that the first offspring of a cow and bull cross would have…

Q: 3) A locus controlling stripe intensity in snakes is known to possess two alleles that are…

A: The problem at hand pertains to a genetic locus in snakes responsible for controlling stripe…

Q: The picture below shows ungulates gathering under a tree during the heat of the day. In the morning…

A: The process of adjusting and adapting the change to the natural environment is called adaptation.…

Q: Classify each specific inhibitor or inhibitor characteristic according to one of two types of…

A: Enzymes are biocatalysts that are made up of amino acids that means they are proteinaceous in…

Q: Around the world, populations near to the equator and in areas of high altitude have darker skin…

A: As per our guidelines, we are supposed to answer only-One question (If there are multiple questions…

Q: What is the difference between the term hominid and hominin? Explain your answer.

A: Primates are a large and diverse group of mammals. They are classified into two groups:…

Q: Why do infants from developing countries lag behind in their growth compared to infants from…

A: In analyzing the growth disparities between infants in growing nations and those in evolved…

Concept explainers

Evolutionary lineages

An evolutionary lineage is a series of populations of organisms that descend from a common ancestor. Each species in the lineage is the direct consequence of evolutionary change from a common ancestor. A phylogenetic tree is generally used to display lineages visually. Lineages are components of the phylogenetic tree of life. Molecular systematics procedures are widely used to predict lineages.

Question

Our species, H. sapiens, derived from:
OH. floresiensis.
●H. ergaster.
O H. habilis.
OH. rudolfensis.
OCT
tv
8
ЛА
W
91

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Criteria of similarity between recent common ancestor of modern man

VIEW

Step 2: Explaining ancestry of modern man

VIEW

Step 3: Explanation for wrong answers

VIEW

Solution

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Table 13: Common Names and Scientific Names of Some Organisms Common Name Genus Name Specific Epithet Squash Cucurbita maxima ofen 199 12. Sampaguita Jasminum sambac Malunggay Philippine eagle Pithecophaga jefferyi Scientific Name Felis catus (animal) Moringa oleifera
Explain the different types of gametes present in each group. Gametes are Swimming gametes > Group Chytrids Zygosporangia > Group Zygomycetes Basidia > Group Basydiomycota Asci > Group Ascomycota
Class: Hepaticopsida Order Marchantiales Species Marchantia polymorpha с длопастей wys 8-12 Cerice meres осубь External appearance structure: 1 - rhizoids; 2- thallus; 3 - male gametophyte (6-9 sections); 4 - female gametophyte (8-12 sections); 5 - sporophyte
Oa. G. fusca O b. G. pallida Considering the tree above, which species should share the greatest number of homologies with G pauper? OC. G. scandens O d. G. platyspiza G. fuliginosa G. fortis Oe. G. olivacea G. magnirostris G. conirostris G. scandens G. difficilis G. pallida G. parvulus G. psittacula G. pauper G. Platyspiza G. fusca G. Pinaroloxias G. olivacea
What is the name of the following species? The one on the right. One word.
The binomial epithet of garden pea is Pisum sativum Linn. What does Pisum represent? Generic name Specific epithet Species Author citation
Based on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂
The group depicted above (red circles) is_ O Paraphyletic Monophyletic O Polyphyletic Not phyletic
Why would you think twice about ordering from a restaurant menu that lists the specific epithet but not the genus name of its offerings? Hint: Look up Homarus americanus, Ursus americanus, Ceanothus americanus, Bufo americanus, Lepus americanus, and Nicrophorus americanus.
The species is aye aye
What notion is common to each of the species difinitions, morphological, phylogenetic and biological species concepts
Below are phylogenetic trees depicting the relationships among four species, A, B, C, and D. Which of the following statements is correct? ABCD ADCB DCBA D CAB (1) (2) (3) (4) Tree (1) and Tree (2) are the same tree. Tree (2) and Tree (4) are the same tree. Tree (2) and Tree (3) are the same tree. All four trees are in fact the same tree. All four trees are in fact different trees.