Match each term on the left with the best example on the right E photosystems NADP+ E G3P molecule chlorophyll E electron carrier molecule product of Calvin Cycle E pigment molecule photosynthetic pigments gathering light energy

Match each term on the left with the best example on the right E photosystems NADP+ E G3P molecule chlorophyll E electron carrier molecule product of Calvin Cycle E pigment molecule photosynthetic pigments gathering light energy

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter6: Where It Starts-photosynthesis

Section: Chapter Questions

Problem 15SA: Match each term with its most suitable description. ____ PGAL formation a. absorbs light ____CO2...

See similar textbooks

Related questions

Q: Fill in the purity reading of each either good or bad sample as well as the remarks what makes the…

A: There are few important points: RNA is synthesized by four types of ribonucleotides and joined by…

Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.

A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…

Q: need help finding the right answers there are mutiple answers please

A: In a coelomate, the lining of GI is different from the lining of internal organs and hence the first…

Q: As climate change becomes a growing problem, studies are conducted to under the im- pacts on…

A: Climate change impact on tawny owls in Finland :-

Q: What term describes the substance that is bound by an enzyme and converted to product? O a. Coenzyme…

A: Enzymes are biological macromolecular catalysts. Chemical reactions are accelerated by enzymes.…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Where on the cladogram would you place the common ancestor of brown algae and water molds? The…

A: A cladogram is a diagram that shows the evolutionary relationships between organisms. It is used to…

Q: With only one exception, the most commonly used STR loci are spread across the human genome, each on…

A: The most common short tandem repeat (STRs) inside the human genome are dinucleotide repeats. STR…

Q: What is the mechanism behind the success of vaccines to eradicate or reduce infectious diseases such…

A: Vaccination refers to the process of immunizing individuals before they get infected with a disease.…

Q: Which among the following statements is NOT an important function of skeletal system? OA. calcium…

A: Skeletal system is the body's main central framework. It consists of bones, connective tissues such…

Q: State the three main functions of the digestive system.

A: Digestion involves two aspects- mechanical digestion and chemical digestion. Mechanical digestion is…

Q: Leaves typically have high surface area to volume ratios to maximize the rate of photosynthesis.…

A: Xerophytes have lower or less surface area of leaves than other plants. This adaptation is due…

Q: What is the full regulatory pathway of glycogen synthase and glycogen phosphorylase by insulin and…

A: Insulin is a protein hormone which is secreted by the beta cells of the islets of Langerhans in…

Q: 15. Why is PK > PNa and by about how much?

A: Action potential Action potential is a sudden change in the resting membrane potential of the…

Q: Genes are made by- (A) Histones (B) Lipoproteins (C) Hydrocarbons (D) Polynucleotides

A: The DNA or deoxyribonucleic acid is the genetic element in living organisms that determine the…

Q: Which is NOT a role of sebum in the innate immune system. Group of answer choices dehydrates…

A: Sebaceous glands are present on the skin. The glands are mostly present on the chin, forehead and…

Q: Explain, in detail, how tyrosine kinase proteins are involved in one signal transduction pathway of…

A: The signal transduction pathways in cell occurs via three types - G protein couple receptors,…

Q: (a) Distinguish between micelles, liposomes, bilayers, vesicles, and membranes. (b) Discuss the role…

A: Ans a- Liposomes are composed of a lipid bilayer separating an aqueous internal compartment from the…

Q: List some of the variations in eudicot leaf structure.

A: Eudicots are dicotyledons which means plants have two cotyledons in their seeds. Monocots are plants…

Q: List some differences between eudicots and monocots

A: Introduction :- The term eudicots, also known as tricolpates, refers to real dicots, which are…

Q: What is an example of a lab experiment that shows the variation of the photosynthesis efficiency in…

A: Introduction - The fraction of light energy turned into chemical energy during photosynthesis in…

Q: When a certain body arna manitest an typeromia, increased capilary fitration and sweoling, mis…

A: Introduction Hyperemia is a condition in which there is an excess of blood in the vessels of a body…

Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…

A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

Q: You have counted a total of 6.4 x 10° cells /ml in preparation for plating cells at a concentration…

A: The answer is 1.17 mL of cells and 3.83 mL of medium

Q: To explain: In terms of natural selection the reason why no new puriri trees in New Zealand are…

A: The Kereru birds are native pigeons found throughout New Zealand. Many trees rely solely on these…

Q: Name of organisı Features used to ID: d.

A: The given diagram shown is the diagram of the filamentous green algae that lives in the fresh water…

Q: 14. Why is titin important with respect to muscle contraction?

A: Introduction Titin:- It is a protein that in humans is encoded by the TTN gene, it is the largest…

Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…

A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: of В C

Q: How does intermittent fasting relate to carbohydrates, lipids, proteins, nucleic acids, enzymes etc.…

A: Intermittent fasting (IF) is a term used to describe a variety of eating patterns in which no or few…

Q: Examining Table 20-5, how would the interpretation ofthe McDonald–Kreitman test results differ if…

A: Ans. The synonymous mutation is silent mutation, which non-synonymous mutation change the nucleotide…

Q: 32) An origin of replication is given below. Sequences of selected parental strand regions are…

A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Why is Cyanotic heart disease important to know ?

A: Introduction The heart is a an organ that circulates blood throughout your body. It is your…

Q: What are the divisions of white light according to the electromagnetic spectrum? Which are the two…

A: Chlorophyll can be referred to as the pigment associated with providing plants their green color and…

Q: Question 88 How is a child with Type I diabetes similar to a child who is starving? Mark all that…

Q: During ejaculation, sperm cells and semen is released from the reproductive tract of a male. What…

A: Ejaculation It is the process through which sperm cells and seminal plasma from the male…

Q: Which of the following is NOT a type of cell? A. ribosome B. haemocytoblast C. neutrophil D.…

A: Answer

Q: you perform a cross of two heterozygous, red-eyed flies. They have 100 offspring. How many of these…

Q: QUESTION 28 The flies in the figure are mated. Which chromosomes would have the highest frequency in…

A: A breeding experiment among two animals that are exactly hybrid for two features is referred to as a…

Q: Termites digest wood with the help of an enzyme secreted by the- (A) Salivary glands (B) Cells in…

A: Termites are also known as cellulose eating insect, belong to phylum Arthropoda.

Q: A nuclear power plant employee, 20 years old, was entered the hospital with a diagnosis of "acute…

A: Acute radiation sickness is condition which occurs in a person who has been exposed to a high amount…

Q: sabuoraud slope culture contains a black mould. describe a diagnostic method you can use to identify…

A: Answer :: The Donas do Sabor Festival, a delightful tour of Salvador's kitchens run by women, has…

Q: Heterocoelous centrum is a characteristics of- (A) Amphibia (B) Reptilia (C) Birds (D) Mammalia

A: Introduction - Multicellular eukaryotic animals make up the animal kingdom. Invertebrates and…

Q: What is the mechanism for lymphocyte maturation so that lymphocytes will respond to non-self cells…

A: Introduction:- White blood cells, or lymphocytes, are one of the body's main types of immune cells.…

Q: 5. How might exposure to a more acidic pH affect the growth, development and reproduction of sea…

A: Sea urchins come under the category of keystone species, indicating their abundance has a direct…

Q: 2) Cows were domesticated from wolves approximately 20,000 years ago, likely in Europe . Mutation…

A: Natural selection is an evolutionary process proposed by Charles Darwin in the year 1859. His theory…

Q: Give examples of effective and ineffective gene therapy. Describe each and discuss in 150 words

A: Gene therapy is a process in which the underlying disease present in the genes can be corrected by…

Q: 13. Why does mega dosing of a single mineral inhibit the absorption of other minerals?

A: Minerals: Minerals are the essential substances that are needed in our body in order to develop and…

Concept explainers

Photosynthesis

Plants have a capacity that we humans can only imagine— the ability to produce food from sunlight. Sure, we can prepare some dishes that we can savor on, but it become possible because of the plants (as they serve as a producers of all the raw materials required). Photosynthesis is the method of assembling carbohydrates with the aid of sunlight.

Question

Match each term on the left with the best example on the right
18
E photosystems
NADP+
E G3P molecule
chlorophyll
E electron carrier molecule
product of Calvin Cycle
E pigment molecule
photosynthetic pigments gathering light energy

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Where in plant cells does the Calvin cycle take place? a. thylakoid membrane b. thylakoid space c. stroma d. granum
Figure 8.18 Which of the following statements is true? In photosynthesis, oxygen, carbon dioxide, ATP, and NADPH are reactants. G3P and water are products. In photosynthesis, chlorophyll, water, and carbon dioxide are reactants. G3P and oxygen are products. In photosynthesis, water, carbon dioxide, ATP, and NADPH are reactants. RuBP and oxygen are products. In photosynthesis, water and carbon dioxide are reactants. G3P and oxygen are products.
Match each term with its most suitable description. ____ PGAL formation a. absorbs light ____CO2 fixation b. converts light to chemical energy ____ autotroph c. self-feeder ____ ATP forms NADPH does not d. electrons cycle back to photosystem ____ photorespiration e. problem in C3 plants ____ photosynthesis f. Calvin-Benson cycle product ____ pigment g. water molecules split ____ photolysis in photosynthesis h. rubisco function
Diagram 4: The Light Reactions of Photosymtnes STROMA dow soncentrations Photoeystem PhotoeytmE oomple Light Ligt THYLAKOID SPACE Ohigh concentration) Thylakold membrane ATP wynthase STROMA low H concentration) ADP en from a chloroplast inside of a le the light dependent cyde that take place along the thylakoid membrane a Diagram 4 shows a single thylakoid membrane In photosystem I and II, an electron will O be transferred to ATP be transferred to NADPH lose energy gain energy
Diagram 4: The Light Reactions of Photosynthesis STROMA dow concentralion Photonystem B Cytch e Photosystem Light omplex Light NADP reductoe NADP NADPH THYLAKOID SPACE igh ooncentration) Cavin Cyle Thylakid menbrane ATP STROMA ow H eone sythase ADP ATP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell. The events of the light dependent cycle that take place along the thylakoid membrane are shown. Light energy is captured by O ATP synthase O Photosystems I and II O NADP+ reductase The thylakoid membrane's lipid structures Drovious
The light reactions of photosynthesis take place in the thylakoid disk the outer membrane of the chloroplast the stroma of the chloroplast cytoplasm of the host cell
Diagram 41 The Light Reactions of Photosynthesis STROMA Poteyte Potayate mples HAD Light HLARO ACE (high ir Carto Thylakold membrane ATP ynthase STROMA ow N concentration) ADP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell. The events of the light dependent cycle that take place along the thylakoid membrane are shown. Identify an energy transfer that takes place n Diagram 4. Light energy is directly transferred into the chemical bonds of sugar. O Light energy is directly transferred into the chemical bonds of ATP The energy of the bonds of water are transferred into the chemical bonds of ATP. The energy from an excited electron is transferred into the chemical bonds of NADPH.
MAD SPACE Thyld ATP Diogram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell the light dependent cycle that take place along the thylakoid membrane are sho Water is important to the production of ATP because water will O provide the electrons that flow through the ATP synthase Oprovide the energy for ATP synthase to transfer into the bonds of ATP. flow through ATP synthase allowing for the production of ATP O provide the H that flows through the ATP synthase allowing for the ATP production.
O, + H,O + Light Energy → C,H,,0, +. Reactants Energy is captured from Products Granum photosynthesis to occur. order for Stroma Lamellae Chloroplasts Outer Membrane Inner Membrane
Diagram 4: The Light Reactions of Photosynthesis STROMA (low H* concentration) Cytochrome complex Photosystem I Photosystem I Light NADP reductase 4H NADP + H NADPH THYLAKOID SPACE (high H* concentration) 4 H* Thylakoid membrane ATP synthase STROMA (low H concentration) ADP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a the light dependent cycle that take place along the thylakoid membrane In the Thylakoid space water is split into O 02 H* and electrons O H*, ATP and O2 O Photosystem II, electrons and oxygen O 02 and chlorophyll
Which of the following reactions produces the oxygen released by photosynthesis? chemiosmosis reduction of NADP+ splitting of water molecules electron transfer in photosystem I
Dlagram 4: The Light Reactions of Photosynthesis STROMA ow soncedration Oytnho e mples Photoeystem B Photoeystan I NADP Light OPM THYLAKOID SPACE gh r cenentration Cavin Cyele Thylakoid membrane ATP STROMA dow H ooncentration) ythse ADP Diagram 4 shows a single thylakoid membrane taken from a chloroplast inside of a leaf cell. The events of the light dependent cydle that take place along the thylakoid membrane are shown. ight energy is captured by ATP synthase O Photosystems I and II D NADP+ reductase O The thylakoid membrane's lipid structures