Match each indicator species with the appropriate region: Western Great Lakes - St. 1. White-tailed Jackrabbit Lawrence Forest Region 2. Lakeside Daisy Carolinian Forest Region Bruce Peninsula 3. Tulip Tree Hudson Bay Lowland 4. Lesser Yellowlegs Frontenac Axis 5. Pitch Pine > > > > >

Q: During one cross-bridging cycle in striated muscle one ATP molecule is hydrolyzed. Explain the two…

A: In striated muscles, during a muscle contraction, tropomyosin has to change its conformation to…

Q: ing to the video "Ben Goldacre: Battling Bad Science" from Assignment 5.2, which e statements is…

A: Placebo is a kind of substance which produces no medical effect. Placebo is given to create a  false…

Q: Why do Fast-glycolytic fibers fatigue rapidly?

A: Introduction: The soft tissue present in almost all mammals is the muscles. The muscle cells…

Q: Summation of contraction is also known as wave summation . Describe the role of calcium in wave…

A: The primary function of wave summation is to produce a smooth and continuous muscle contraction. It…

Q: Part B. Myoglobin Final Structure Tertiary or Quaternary Oxygen Binding Affinity Curve is…

A: The transportation of oxygen from atmosphere to the individual cells  occurs through a series of…

Q: "Motor neurons trigger action potentials in muscle cell membranes that open voltage-sensitive Ca2+…

A: Introduction: The contraction of the muscle is significantly influenced by calcium ions. When…

Q: Define tetanus

A: Any imbalance in the body due to lack of nutrients, invasion of any foreign agent, or any accidental…

Q: A skeletal muscle can often maintain a moderate level of active tension for long periods of time,…

A: A neuromuscular junction also called the myoneural junction is a chemical synapse between the motor…

Q: Explain why skeletal muscle cells contain many mitochondria.

A: Mitochondria is a cell organelle found in the cytoplasm eukaryotic cell. It is a double…

Q: B-What does it mean "redox steps" in some steps of the glycolysis? (Less than two sentences). (8…

A: Redox reaction Chemical reaction in which electrons are transferred between two reactants…

Q: movement of sodium ions into the muscle cell at the nueromuscular junction causes wha

A: Neuromuscular Junction (NMJ) is the junction between the terminal branch of the nerve fiber and the…

Q: The force of muscle contraction may be altered by increasing/decreasing the stimulus interval…

A: Muscle Contraction: It is the activation of tension-generating sites within muscle cells.

Q: Rigor mortis is usually complete within 1 to 2 days after death (depending onenvironmental…

A: Introduction: When muscle fibers are completely depleted of adenosine triphosphate (ATP) and…

Q: Need quick response.

A: We know that The involuntary muscles composed of cells called Cardiomyocytes found in the heart…

Q: A) tetany is rapid spasm in the muscle. B) Tetany is usually caused by an increase in the blood…

A: Introduction: Tetany occurs in muscles that have no absolute refractory phase. The heart's muscles…

Q: Magnesium blocks voltage-gated calcium channels on the membrane of smooth muscle cells. How do…

A: Inorganic ions are also important players in regulating our metabolism and overall working may it be…

Q: Neuromuscular junction, explain how this disorder can lead to progressive weakness of the skeletal…

A: Neuromuscular junction is basically the junction between telodendrites of motor  neuron and muscle…

Q: Explain the term bolting?

A: Plants synthesize certain organic compounds in a very small amount. However, these compounds are…

Q: Skeletal muscle is visually distinctive (viewed in longitudinal section) in that it appears as long,…

A: In this answer, I will describe the appearance of striations in skeletal muscle fibers when viewed…

Q: Contrast the “classic” method of achieving a supercompensation of the muscle glycogen stores with…

A: Glycogen could be a multibranched saccharide of aldohexose that is a style of energy storage in…

Q: Given that lactate accumulation will adversely affect endurance, what test might be an indicator of…

A: Maximal oxygen consumption refers to the maximum oxygen that can be utilized by an individual during…

Q: Impairment of intracellular calcium homeostasis in muscle fibers lead to chronic, severe muscle…

A: The sarcoplasmic reticulum(SR) regulates the amount of calcium in muscles. Following an increase in…

Q: Why is the muscle glycogen higher than normal?

A: Glycogen is considered as the complex form of the carbohydrate, which acts as an energy source.…

Q: metabolism of vitamin A  in a power point slide

A: Vitamins Vitamins are the nutrients that are required in small amounts in a balanced diet.…

Q: Explain the reason for each of the four treatments in the RICE approach to muscle injuries?

A: Muscles are the prime organs of the body’s muscular system and there are three categories of…

Q: Cardiac and skeletal muscle are both “striated” types of muscle and yet they have very distinct…

A: The skeletal muscles are a part of muscle tissue in the body. They are attached to the bones by the…

Q: You likely noticed that subjects could not maintain their maximum grip strength for very long but…

A: Muscle unit recruitment is the process by which our body activates motor units within a muscle to…

Q: Provide one difference and one similarity in the process of contraction of smooth, skeletal, and…

A: Muscles are divided into three categories: cardiac, smooth, and skeletal. Cardiac muscle is found in…

Q: Muscle contraction is the biomechanical process of: Ostretching elastic elements to produce force…

A: Introduction  Muscle contraction is a physiological process that involves the activation of muscle…

Q: Z1

A: We can say that The muscular system comprises three major types of muscle cells - smooth muscle,…

Q: Which of the following is true when a muscle is at rest: calcium ions bind to the troponin complex…

A: Muscle contraction is the activation of tension-generating sites within muscle cells.

Q: Please answer both questions.  At some point, increasing stimulus strength will not result in a…

A: In most animals, muscle is a soft tissue that is found. Muscle cells produce actin and myosin…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: What is rigor mortis? Explain the physiological rationale of rigor mortis in forensic applications.

A: The interdigitating thick (myosin) and thin (actin) filaments that are formed by the proteins myosin…

Q: What is the optimum muscle activity to undertake for muscular hypertrophy? Explain deeply

A: Muscle hypertrophy is increase in the size mass of muscle due to its excessive constant use.Muscular…

Q: one of the early symptoms of calcium deficiency is muscle cramps. explain why by outlining through a…

A: Muscle contraction occurs when sarcomeres shorten, as thick and thin filaments slide past each…

Q: Most of our movements are classified as tetanic summation titanic twitches

A: Body movement Movement in simplest terms is defined as the state of changing the position of a body…

Q: Why is it possible to get a sustained muscle contraction during tetanus?

A: A tetanic muscle contraction , which is also known as the tetanized state, or tetanus by itself is a…

Q: Why is it in the muscle’s best interest to export lactic acid into the blood during intense…

A: Lactic acid, also known as lactate, is a chemical byproduct of anaerobic respiration, which is…

Q: Maximum contraction strength is achieved when, prior to contraction, the H zone contains no myosin…

A: Skeletal muscle fiber has alternatively  repeating units having alternate light and dark bands known…

Fungal Infections

Fungal infection can be defined as an infectious disease caused by fungi. A fungal infection is also referred to as mycosis. Fungal infections are contagious, spreading from person to person. Mycosis can be contracted even from an infected animal or contaminated soil. The most common symptom is skin rashes and vaginal discharge in females.