List the factors believed to cause the wide variance between the maternal and between the maternal and fetal PO2 and PCO2

Q: What is the tissue labeled A

A: Placozoa is a phylum with single species called Trichoplax adhaerens.

Q: P108 35. (a) How does tissue healing by fibrosis differ from healing by regeneration? (b) Which is…

A: Tissue healing is done via different processes based on the type of cells present in the tissue that…

Q: Tendons and ligaments are made mainly of the protein _____.

A: The cell is the basic structural and functional unit of the body. It carries out various functions…

Q: 2: Societal Issues related to genetic? 9:46 AM /

A: Genetics is defined as that branch of science which involves the study of  genes, heredity and…

Q: What is blubber

A: The group of multicellular and heterotrophic organisms belonging to the kingdom Animalia is called…

Q: What do you mean by chondrocytes?

A: The cell is the basic functional, structural, and biological unit of all known organisms. A cell is…

Q: The thick muscular layer that makes up the septum is the ___

A: Question- The thick muscular layer that makes up the septum is the ___

Q: "Motor neurons trigger action potentials in muscle cell membranes that open voltage-sensitive Ca2+…

A: Introduction: The contraction of the muscle is significantly influenced by calcium ions. When…

Q: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA

A: TACTGTTCAAGCTCCGAAACCAAAAGGGATAATAACCGGCGACGTAAGCGGCCCGCCCGA Know that, The Adenine is always pairs…

Q: Comparision of G1 ,G2 and Sphase?

A: The phases of cell cycles define at what point each phase of the cell cycle is and what are the…

Q: 9. 10 11

A: shown in the image is the x-ray film of the thoracic cavity wherein the gall bladder region is…

Q: Reticular connective tissue (____×) Location _______________________ Function…

A: Connective tissues are formed by the mesoderm of the embryo. Intercellular medium, connective tissue…

Q: What is the importance of meosis

A: Answer: CELL DIVISION : Cell division is the process during which a cell gives rise to new daughter…

Q: Organ A Organ B Figure 2 ) Identify organs A and B in Figure 2 above. O Give a reason for your…

A: In plants, vascular bundle constitute xylem and phloem tissue and are involved in the conduction of…

Q: Mr. Alex was rushed to the hospital after he had an accident. His right leg had swollen, and he was…

A: A surgical procedure called fasciotomy is the most beneficial medication for chronic exertional…

Q: A B C (b) [Choose ] [Choose] [Choose ] <

A: The peripheral nervous system of the body consists of several nerves and ganglia, which play an…

Q: What do you mean by squamous cells?

A: Squamous cells are thin, flat cells that look like fish scales, and are found in the tissue that…

Q: Explain the term bolting?

A: Plants synthesize certain organic compounds in a very small amount. However, these compounds are…

Q: SCANNER LPO HPO 1. Identify the organ 2. Identify the abundant fibers present 3. Identify the…

A: Tissue is the connecting system of our body. Tissue is used to describe a group of cells that are…

Q: The dual faces of life is unity and- Answer:

A: According to the question, we have to provide information on the dual faces of life, one of them is…

Q: Which tissue is indicated by the asterisks? 200um

A: In the given question, we are given an image of histology of hyaline cartilage of human. We have to…

Q: What do you mean by fibroblasts?

A: Connective tissue is a group of tissues in the body that maintain the form of the body and its…

Q: Define columnar

A: The columnar epithelium is made up of column-shaped epithelial cells. The columnar epithelium cells…

Q: Loose (areolar) connective tissue (____×) Location _______________________ Function…

A: Tissues are groups of cells that have similar structure and act together to perform a specific…

Q: Z1

A: We can say that The muscular system comprises three major types of muscle cells - smooth muscle,…

Q: Nervous tissue (____×)Location _____________________Function _______________________

A: The nervous system is the messenger systems in nature. The nervous system uses sensory neurons to…

Q: The smooth muscle tissue is consists of long muscle fibers Called visceral muscle Its cells have…

A: Muscles are the soft tissues that produce force and motion in animals. They are made up of protein…

Q: An individual can accumulate many variations within his/her genome and remain healthy",

A: Variations in species help them to adapt themselves to that particular environment and give them a…

Q: in histology, why is it necessary to cut thin sections of the tissue sample from a specimen?

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: D2. Label the stages of Mitosis using the images shown here ****

A:

Q: Causes of Repetitive Motion Injury .1 * .(RMI) are the following except A) Overuse of one body part…

A: Repeated motion injuries (RMI) include muscle, tendon, and ligament injuries that result from…

Q: true or faluse ??!  Synaptic vesicls store calcium.

A: synaptic vesicles are the vesicles present in the neurons. they are located in the axon terminals of…