Lane 1 = TakaraBio 200 bp DNA ladder Lane 2 = Haell only; (thick band) 1883 bp and 1871 bp, 799 bp Lane 3 = Hindlll only; 4553 bp Lane 4 = Haell + HindllI; 1871 bp, 1531 bp, 799 bp, 352 bp Cat.# 3410A 200 bp DNA Ladder bp 4000 3000 || |

Q: Which would you choose if you needed to make a partial diploid for complementation analysis? rolling…

A: The correct answer is option 1. Rolling circle plasmid.

Q: Do humans have plasmids?

A: Plasmid is the small, circular or linear and extra-chromosomal DNA. It naturally exist in bacterial…

Q: Which statement is NOT the function of restriction enzyme?

A: Answer: It ligates the desired to gene to vector’s plasmid.

Q: triphosphates (dNTPs) or nucleoside triphosphates (NTPS).

A: Viruses are not capable of translating the proteins,  thus they are dependent on host machinery for…

Q: DEFINE THE FOLLOWING: 1) restriction enzyme 2) plasmid 3) recombinant DNA

A: Ans 1) Restriction enzymes are enzymes that are isolated from bacteria that can cleave…

Q: How would a technique of using the luciferase plasmid be to verify that the estrogen receptor was…

A: Tamoxifen is defined as the hormone therapy for "breast cancer " in both men and women. Sometimes,…

Q: Using the plasmid map attached and the answer from the previous question, draw a simplified diagram…

A: The image you provided shows a diagram of the YCplac33 plasmid. This plasmid is a commonly used…

Q: Consider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for…

A: Explanation: A plasmid is a circular piece of DNA that will be utilized in the process of inserting…

Q: The ____ plasmid contains genes for synthesizing connections between donor and recipient cells.

A: The plasmid is defined as a small, circular, extra-chromosomal, double-stranded DNA molecule present…

Q: A plasmid provides its host with kanamycin resistance. What will happen to the plasmid if you…

A: Plasmids are defined as extrachromosomal circular genetic elements that are capable of…

Q: Which plasmid contains the therapeutic gene? 1 - the plasmids with SERCA2a 2- the viral plasmid 3-…

A: The adenoviruses are generally used for making recombinant animal cells.

Q: Study the diagram below. Put the number of the step in the diagram by its description in the list of…

A: Restriction DNA technology can be defined as a set of techniques ; in which DNA is identified DNA;…

Q: How to insert a gene into a plasmid?

A: DNA cloning is the technique to make multiple,identical copies of a particular piece of DNA. For…

Q: Jm109 cells transformed with ligation and plasmid alone is used. The colonies most like:   white…

A: β-galactosidase is an enzyme encoded by the lacZ gene and is used to break down lactose to glucose…

Q: Which of the following statements are TRUE? *

A: Answer is II and III only.

Q: Please answer this question in short but concise and cohesive way. "How would you select the host…

A: Recombinant DNA technology involves the introduction of a particular gene of interest into a host…

Q: Explain how researchers use the Ti plasmid fromAgrobacterium to insert genes into plant genomes.

A: Ti plasmid stands for tumor-inducing. It is found in plasmid family in Alphaproteobacteria. It is…

Q: Q3) Explain the different classification of plasmids

A: Introduction Plasmids are the extra chromosomal DNA found in bacterial cell. Plasmids are small,…

Q: Compare and contrast different types of plasmids?

A: Plasmids Plasmids are extrachromosomal DNA, which is small, circular and double stranded. The…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Restriction mapping involves physically cuttings double stranded DNA by using restriction…

Q: You would like to clone your favorite human gene into an eukaryotic expression plasmid, such as…

A: Ans: The plasmid which is used for the expression of the gene in the form of protein and they have…

Q: Use the figure of a plasmid below to answer the following questions. 43) Which enzyme was used to…

A: Bacteria contain Chromosomal DNA as a genetic material but apart from that it also possess rounded…

Q: Differentiate between TWO of the following pairs: Genetic and a restriction map Southern and…

A: The mapping of DNA refers to the identification of the location of particular genes. Genetic map and…

Q: Using a flow diagram, elaborate on how you would generate a recombinant plasmid.

A: Plasmid is a circular double stranded DNA molecule found in bacteria and is capable of self…

Q: How do you know if a plasmid is taken up by a bacterial cell?

A: In microbiology the term plasmid is used for the tiny extra-chromosomal DNA found in some archaea,…

Q: Write the process of, building a recombinant plasmid? Or how you can build a recombinant plasmid?

A: A plasmid is a circular, single-stranded DNA molecule that is distinct from a cell's chromosomal…

Q: nswer in following heading: What are plasmids ,What are vectors Plasmids in cloning and plasmids in…

A: Plasmids are most commonly used as cloning vectors in gene cloning. To make a recombinant DNA…

Q: Jerome Vinograd found that when circular DNA from apolyoma virus is subjected to cesium chloride…

A: Polyoma virus is the virus that infect the human and establish symbiotic relationship with humans to…

Q: The LB/Amp plate containing E. coli (+)pGLO would be fluorescent

A: The pGLO plasmid you used contains an araC gene, a GFP gene and a bla gene. If you performed the…

Q: The NDM gene is usually plasmid-bourne. What are the implications of this?

A: NDM1 is an enzyme that is used by the bacteria to make itself resistant to the wide range of beta…

Q: ________________ "cut" DNA at specific sequences and the resulting segment with sticky ends is…

A: Recombinant DNA Technology is a kind of technology that utilizes certain enzymes to cut the DNA into…

Q: he cells were incubated for 48 hours after transfection prior to harvesting. The reason for waiting…

A: Transfection : It is the process of artificially introducing nucleic acids into cells ,  to produce…

Q: Which of the following is descriptive of an R plasmid? It has genes for antibiotic resistance O It…

A: A plasmid is a small, circular, double-stranded DNA molecule that can replicate independently from…

Q: A plasmid that encodes for a relaxase complex but does not contain the genes necessary to make a…

A:

Q: Demonstrate a procedure that you could adopt to restrict or digest the TOL plasmid.

A: Plasmids are extrachromosomal, circular, double-stranded, self-replicating DNA. They are naturally…

Q: Define nucleoid and plasmids

A: DNA( Deoxyribonucleic acid)- It is a double helical structure consisting of polynucleotides contains…

Q: Based on the image below, answer the following questions:   Restriction enzymes PstI and ScaI were…

A: Restriction enzymes  These enzymes have the capability to identify and cleave specific restriction…

Q: Consider a hypothetical phage whose DNA replicates exclusively by rolling circle replication. A…

A: As per semi conservative model of DNA replication, the newly synthesized daughter DNA molecule will…

Q: For the following sets of partial diploid bacteria, is the Z gene constitutive, inducible, or…

A: An inducible gene is a gene that can be turned on or off in response to specific signals or…