Q: Which of the following statement is correct? a. In insertion mutation, an organic compound insert i...
A: Alternation of DNA sequence takes place in mutation which results in change in genotype and phenotyp...
Q: What are the various names of articulations based on movement?
A: Articulation is a joint between bones or cartilage in the skeleton of an animal. Joints or articul...
Q: Which parameter from the software must you adjust in order to give a "selection advantage" to organi...
A: Evolution is the branch of science which deals with change in the species and its characteristics ov...
Q: WHAT ARE THE CONCEPT, APPLI AND IMPORTANCE OF THE FOLLOWING? I. Translocation through an artificial ...
A: Osmosis : Osmosis is the spontaneous movement of solvent molecules through a semi permeable membran...
Q: You are trying to predict phenotypes for abdominal bristle number in a population of fruit flies usi...
A: The term heritability can be described as the measure used for finding out a particular trait’s degr...
Q: Tabulate the results of your two-point threshold experiment and produce the homunculus.
A: Answer
Q: What was Darwin “wrong” about The Tree of Life?
A: The common descent theory, also known as the theory of evolution, is a well-known theory developed b...
Q: mammal
A: Mammals are a group of vertebrate animals.
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: What is the number and types of lamprey species that are present in the Great lakes?
A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...
Q: What life experiences can someone havethat might coil or uncoil your DNA?
A: Epigenetics is an study of effects that environment and behavior have on genes.
Q: Which is false about respiratory systems??  a. Usually the higher the metabolism, the more efficien...
A: The respiratory system is essentially a biological system in animals as well as plants that consists...
Q: In 2013, there was an outbreak of methicillin-resistant Staphylococcusaureus (MRSA) at an NFL traini...
A: Introduction Gene Regulation: The expression of genes is highly regulated in both prokaryotes as we...
Q: Describe Affinities of cycadofillicales.
A: Cycadofilicales is the order of division gymnosperm, as divided by Chamberlain according to his clas...
Q: Provide a brief overview of Environmental Concerns, Impacts, and Sustainablllty of Coastal Fishing P...
A: The environmental impact of fishing includes issues such as the availability of fish, overfishing, f...
Q: Why is there a need to classify the great diversity and life?
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: Choose all that apply Which bones are part of the axial skeleton? Group of answer choices Ribs Clavi...
A: Locomotion in animal is accomplished by the force of muscles acting on a rigid skeletal system. Skel...
Q: widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her brother both have a ...
A: Introduction:- A Punnett square is a representation of how different gametes combine to produce dis...
Q: Is the inheritance autosomal or sex-linked?
A: The genes are located on the specific region of the DNA. Genes determine the phenotypic characterist...
Q: Explain how coenzymes connect the light-dependent reactionswith the Calvin–Benson cycle
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: On which sex is the frontonasal angle sharp and angular?
A: The answer to this question is B. i.e. females. They have the frontonasal angle sharp and angular. H...
Q: Dr. Krishna at CSU has been conducting research on snake venom. Similar to Dr. Krishna, a scientist ...
A: clusturing of species arises whether species coexist by partitioning resources, environmental prefe...
Q: Please answer fast When setting up crosses to determine map distances, why do geneticists prefer to...
A: There are some points regarding genetic map which are as follows: the linkage of the genes in a ch...
Q: CAPSLOCK ON - What Does It Mean?
A: CAPSLOCK ON- on a computer keyboard means that whatever you type from now on will be typed on in cap...
Q: Match the definition to its corresponding term. Formation of a pilus to allow genetic exchange betwe...
A: Answer
Q: Consider the endomembrane system. Explain how a CFTR protein would be produced/synthesized in a lung...
A: CFTR ( cystic fibrosis Transmembrane receptor) protein is help in regulation of chloride and sodium ...
Q: Help explain this LAPTM5 and LAPTM5 restrict HIV-1 infectivity
A: Answer
Q: Describe how temperature and pH affect enzymes.
A: Enzymes are basically proteins so they unfold and denature at high temperture.This denaturatio cause...
Q: taxonomical heirarchy
A: Taxonomic hierarchy is the process of arranging various organisms into successive levels of the biol...
Q: What type of risks do genetically modified food potentially pose?
A: Genetic modification is a methodology used in the biotechnology which involves alterations of traits...
Q: Classify and diagram embryos on the basis of their: (a) yolk content, (b) cleavage types, (3) cleava...
A: Cleavage in animals is depends upon amount of yolk. Yolk distribution can be complete ( holoblastic ...
Q: which lampreys are parasitic and which are not in the Great Lakes?
A: The Great Lakes is a series of large interconnected freshwater lakes in the mid-east region of North...
Q: Which of the following would not be an example of a quantitative trait? O All of these are quantitat...
A: Introduction The classical Mendelian traits are generally considered to be Qualitative in nature i....
Q: 1. Which organisms in the cladogram in figure 1 have fur and mammary glands? 2. Which organisms in t...
A: There are few important points that are as follows : We know that the evolutionary relationship of ...
Q: Most of the carbon dioxide that plants use for photosynthesis comes from______ . a. glucose c. rainw...
A: photosynthesis is the process that plants use to turn carbon dioxide and water into glucose and oxyg...
Q: On which bone are the Temporal Lines located? Group of answer choices Frontal Radius Occipital Maxil...
A: Temporal Lines are located in frontal bones and parietal bones.
Q: Retinitis pigmentosa, a group of related eye disorders that cause progressive vision loss, is due to...
A: For retinitis pigmentosa , gene : R gene RR and Rr genotype for disease and rr for normal individ...
Q: Name and describe two properties of water that make it unique and required for life on earth.
A: The Earth is covered with 78% water. It is the most abundant substance on Earth. The first life orig...
Q: 1. Which type of evidence for evolution is most accurate in determining evolutionary relationships-m...
A: There are many arguments in the past about which type of evidence is most accurate in determining ev...
Q: . How would you reply to someone who argues thatwe should not worry about the effects that humanacti...
A: Natural resources and deterioration of environment is the major problem which leads to lot of seriou...
Q: Why would adults be more likely to have an allergy to an insect venom than a child? Give one hypoth...
A: Anaphylaxis is a severe allergic reaction, which occurs in body as response to insect venom.
Q: Who was responsible for the X-ray crystallography that determined the shape and structure of DNA? O ...
A: Given: DNA is along polymer of Deoxyribonucleotide. It is made up of two polynucleotide chains that ...
Q: A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effe...
A: D. Both A and B are incorrect. There is no change in the DNA sequence if nucleotides are added or re...
Q: 1. Molecule #1 a)What Group? (Carb, Lipid, Protein, or Nucleic b)Acid). Within the group, how would ...
A:
Q: describe how stress is a process. Include stimulus, response and process
A: There are few points : Stress can be defined as it is impossible to avoid . It is an external event...
Q: Describe the interactions of adrenal medullary and cortical hormones in response to stress (Cannon's...
A: Hormones of adrenal cortex especially cortisol responsible for long term stress however hormones of ...
Q: how do organisms without a swim bladder behave?
A: * swim bladder is also called Air bladder and Gas bladder. *Swim bladder is an internal organ which ...
Q: In cats, fur color is a sex-linked trait, where black fur is dominant over yellow fur. If a calico f...
A: Genetics is the discipline of science concerned with the study of genes and their transmission from ...
Q: EcoRI 290 bp 3800 bp EcoRI PUC19 PUC19 3400 bp Bgll EcoRI 290 bp EcoRI 1900 bp PUC19 1500 bp
A: A plasmid circular, small, extra chromosomal double stranded DNA (dsDNA). pUC19 plasmid is one the p...
Q: Basic Alternation of Generations. What are the structures in plant life cycle that are haploid?
A: Alternation of generations means that the plant's life cycles alternate between diploid (sporophyte)...
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 11 of 11 What volume (in µL to 1 decimal place) of stock SybrSafe solution (3.4 mg/mL) would you add to 120 mL of agarose solution to give a final concentration of 0.4 pg/mL? Answer: Submit < Previous Question Assessment Navigator Questionmark Ondemand licensed to University of Dundee DII DD 80 000 000 F10 F8 F9 F7 esc F5 F6 F3 F4 F1 F2 24 ... 6 7 * 00Solution Absorbance mg/ml aspirin Standard solution - 1.6 mg/mL A 0.638 0.08 mg/mL B 0.504 0.064 mg/mL C 0.376 0.048 mg/mL D 0.259 0.032 mg/mL E 0.126 0.016 mg/mL A = -log T where T = %T ÷ 100 Construct a callibration curve using the above data. Absorbance should be on the vertical axis and "mg/mL of acetylsalicylic acid" on the horizontal axis. The line should go through the origin. Using the data provided, the graph you have generated, and the procedure that was used to generate the solutions which were examined by spectroscopy, calculate the amount of acetylsalicylic acid per tablet. Commercial tablet 1 labelled as 100 mg enteric coated Absorbance = 0.16 Commercial tablet 2 labelled as 300 mg Absorbance = 0.45 Student prepared tablet from practical 5 Absorbance = 0.19 Using the data provided, the graph you have generated, and the procedure that was used…Desired Desired Initial Volume of Stock or Volume of Concentration Volume Concentration Previous Dilution Distilled Water (C2) (V2) (C1) (V1), µL (V2- V1), µL 100 mg/dL 1.2 mL 200 mg/dL 75 mg/dL 1.2 mL 100 mg/dL* 50 mg/dL 1.2 mL 25 mg/dL 1.2 mL
- 1&1/2 tsp po BID x 14 days #QS How many milliliters should the pharmacy dispense?Penicillin G potassium 5000 units Isotonic Sodium Chloride Solution ad 15 mL Sig. Nose drop Using soluble penicillin tablets, each containing 100,000 units of crystalline penicillin G potassium, explain how you would obtain penicillin G potassium needed in compounding the prescription.Augmentin (amoxicillin and clavulanate potassium) 500 mg PO q8h. The strength on the label is 250 mg per 5 mL. How many milliliters of this antibiotic will you administer?
- What rate in mL/hr of Isosource VHN would provide 1.6 g protein/kg/day if run for 24 hours for a patient weighing 68 kg? Round to the nearest whole number, do not enter units EN Product Кcal Protein /mL g/L General Formulations Jevity 1.5 1.5 63.4 Isosource VHN 1 62 TwoCal HN 2 83 Renal Formulations Nepro 1.8 81 Renalcal 2 34.4 Supplena 1.8 45 Glucose Control Formulations Glucerna 1 41 Choice DM 1 45CAR) All una Red stock soluton concentration: wis strue Somple #yelume dilution 1 ete total tock AR volume 50.00m 50. 00mL 50.00L AR COC conentrastion Absorbance Q dilutibn 2 dilution 3 10 O. 16.4 20 0. 237 turn dilution 4 25 So00 O. 392 shift unknarn 1 0.485 (Include a printed copy of the colibratlon curve) Colibrotion urve cayotion: R2 valve46 50 52 60 41 46 55 Find the ff. WITH SOLUTION PLEASE MeanMedianModeSDVarianceCVQuartile 2Decile 7Percentile 25Percentile 30
- Match the number in the image with the correct name for the lab supply 1 2 ♡ AGEN QIAGEN QIAGEN QIAC RIVCEM БИЗӘДІС RNeasy Mini Kit (50) Cat. No. 74104 Store at room temperature (15-25°C) WEZAIO QIAGEN 2 GDIVERM QIAGL K (20) QIAGL умени DAIO QIAG GAGEN GIVCEN QIAGEN QIAGEN ИЗОМО QIAGEN NEA QIAGEN QIAGEN N QIAGEN QIAGE Buffer W AGEN Lysis buffer 45 m Buffer RPE Wash buffer 11 ml concentrate to ustan 5 m Butter R U 3 clear collection tube centrifuge tube pink column (with filter) PhaseLock tube pink column (with filter) inside a clear collection tube <Rx Of oxacinophtalmic solution 3% Disp. 10 mL How many milligrams of axacin contained in each milliter of the dispensed prescription?After three minutes, the concentration of drug Zip in the red blood cells is 10 mmoles l-1. What is the average rate of entry of drug Zip into the red blood cells in units of moles min-1 red blood cell-1 during the first three minutes after placing the red blood cells into the bathing solution? Assume that each red blood cell occupies about 1 x 10-13 liters.