In what types of cells would you expect de novo methylation tooccur? In what cell types would it not occur?

Q: Much of DNA methylation in eukaryotes occurs at CpG dinucleotides, but some individual cytosine…

A: Epigenetics of gene expression allows heritable changes in gene expression without altering the DNA…

Q: Briefly explain how patterns of DNA methylation are transmitted across cell divisions.

A: DNA methylation is a biological mechanism that attaches methyl groups to DNA molecule. Methylation…

Q: What structures are found in a chromosome? Group of answer choices Two structures for the mitotic…

A: structures  found in a chromosome :  Two structures for the mitotic spindle to bind, and one complex…

Q: Outline the molecular steps in the process of X-chromosomeinactivation (XCI). Which step plays a key…

A: Euchromatin is defined as the active form of chromosomal DNA whereas heterochromatin is defined as…

Q: why The chromatids formed byrecombination within the inversion loop of a pericentric…

A: When the region between two breaks of the same chromosome rotate 180°, it results in chromosomal…

Q: What is DNA methylation? When we say that DNA methylation is heritable, what do we mean? How is it…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: In eukaryotes which of the following combination of chromatin conditions would be most likely to…

A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear membrane.Eukaryotes…

Q: Much of DNA methylation in eukaryotes occurs at CpG dinucleotides, but some individual cytosine…

A: The most common epigenetic change is methylation in which a methyl group is added to the DNA…

Q: On which type of chromosome would you expect theleast number of new mutations per base pair? Why?

A: Chromosomes are thread-like structures present inside the nucleus of the cell. They are made up of…

Q: In mammals, individuals with two X chromosomes usually de-activate one of the X chromosomes inside…

A: The cell has two kinds of chromosomes. These are sex chromosomes and autosomes. There are two sex…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: Explain why a cell lineage diagram is necessary to determine if a mutation is heterochronic.

A: Cell lineage means the developmental history of progress of a tissue or any other organ of any…

Q: Why would a mutation in a somatic cell of a multicellular organism not necessarily result in a…

A: Eukaryotic organisms have two types of cells: germ cells which produces gametes and somatic cells…

Q: Colchicine is a chemical mutagen that inhibits the spindle formation and prevents anaphase, which…

A: Introduction  Cell cycle have different phase which is broadly divided into two Interphase and M…

Q: Use the dropdowns to indicate the pattern of methylation and gene expression expected for a…

A: Here's a breakdown of the key points:Somatic cell inheritance: Somatic cells inherit one allele from…

Q: What chromosome rearrangement is thought to be the source of new genes?

A: Chromosome rearrangement is a change in the order of base sequences along one or more chromosomes.…

Q: Why do some chromosomes display a higher incidence of amplification/deletion compared to others?

A: When the nucleotides sequences in the genome of an organism are altered or changed due to mistakes…

Q: Why is it important for a chromosome to be copied before mitosis?

A: Mitosis is a process of cell division in somatic cells. In this cell division, cells divide into two…

Q: Why do some genes express themselves later in life? Why not earlier? How many chromosomes in a human…

A: Some genes are expressed later and not earlier:Gene expression is defined as the process by which…

Q: In the experiments described , explain the relationshipbetween coat color and DNA methylation. How…

A: Epigenetics studies the heritable changes of gene expression which do not include the changes occur…

Q: What role does reverse transcription play in chromosomal maintenance?

A: Reverse transcription is the process by which RNA is reverse transcribed into DNA by the enzyme…

Q: ow does DNA methylation occur? What enzyme is involved in DNA methylation? What are the consequences…

A: Since you have multiple questions, am answering the first question for you, for the remaining…

Q: Would a cell with a point mutation or a deletion be more likely to revert back or maintain the…

A: Changes or alterations in the genetic material of an organism that lead to mutations. Mutations are…

Q: If transmission of genetic information from cell to cell is normally achieved by copying the…

A: Introduction: Nucleic acids are one of the major molecules comprised of a nitrogenous base, a sugar…

Q: Why is a chromosomal fragment without a centromeresubsequently lost and degraded?

A: The changes in the structure of the chromosome and genes are called chromosomal mutations. The…

Q: Which of the following observations give support to the idea that changes in chromatin structure…

A: Introduction : The complex of DNA and proteins that makes up the chromosomes' structure in…