In this depiction of trascription, the ___ strand is ___ because it ___.   upper; RNA; contains guanine   upper; RNA; has no uracil   lower; DNA; contains adenine   lower; RNA; contains thymine   upper; RNA; contains uracil

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .…

A: DNA, short for deoxyribonucleic acid, is a nucleic acid molecule made up of a sugar called…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: RNA is pretty easy to make into DNA because it's single stranded , doesn't form as many structures,…

A: The first step a cell takes to read out a genetic instruction is to copy a particular nucleotide…

Q: DNA MRNA Amino Acid

A: It is on the basis of centra Dogma of molecular Biology. central dogma is the process by which DNA…

Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…

A: Replication, transcription, translation are the three processes of central dogma of life.…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: RNA occurs primarily as single strands and can adopt more compact structures than DNA molecules.…

A: Nucleic acids are molecules that help in storing information to be used for cellular growth as well…

Q: Small nuclear RNA from 50-200 bases that combine with proteins to form complexes capable of editing…

A: RNA editing is a post-transcriptional modification process that alters the sequence of RNA…

Q: Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5'…

A: Transcription is the process of synthesis of mRNA using one of the strands of the DNA. During this,…

Q: The following strand of DNA is transcribed: 5'-GACCTCCGAATGC-3' Write the sequence of the…

A: Transcription:  It is the process of synthesis of mRNA from double-stranded DNA by the enzyme RNA…

Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…

A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…

Q: Match each of the following terms with the one definition that best describes it. Any of the…

A:

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: DNA nucleotide base pairings: Thymine pairs with ___________________________, Cytosine pairs…

A: DNA is a nucleic acid made up of several units of nucleotides joined end to end. A nucleotide is…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: If the sequence of one strand on DNA is… CTA GCT CCA its complementary strand will be… _____________

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: Part A Drag the labels onto the diagram to identify the structural elements of a DNA molecule.…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of two…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Inside the nucleus of a eukaryotic cell you will find DNA associated with proteins. This combination…

A: A eukaryotic cell is a type of cell that has a defined nucleus and other membrane bound organelles.…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is…

A: Redundancy refers to differences in the third base of the codons coding for the same amino acid.

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Answer the following 2 questions based on the given sequence of DNA. The top strand is the template…

A: The central dogma of DNA consists of transcription and translation. In transcription, the DNA makes…

Q: The following is the base sequence on the coding strand of a DNA molecule: AAT GCC AGT GGT TCG CAC…

A: A mutation in genetics is a change to a gene's DNA sequence. These alterations may happen naturally…

Q: A  partial DNA template has the following sequence of nucleotide bases: A-C-G-T-A-C Type the…

A: DNA or deoxyribonucleic acid is the genetic material in all living organisms that is composed of…

Q: A virus has a double-stranded RNA genome that has 2400 base-pairs. Of these, 35 % are G:C…

A:

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: A large number of nucleotide base pairs along a DNA molecule is a specific region  called a  _____

A: DNA is made of nucleotides. Nucleotides are made up of phosphate, sugar, and a nitrogenous base.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.