In order to view Treponema pallidum, the causative agent of syphilis, under the microscope, you can tag the specimen with an antibody-flourescein dye complex and look under a microscope that projects UV light onto the specimen. What test are you using?
Q: Brainstem-Controls breathing and heart rate Test 1: Whole Brains (not to scale) Mouse Cat Baboon Hum...
A: Cerebellum is the part which is located at the back of brain underlying the occipital and temporal l...
Q: Mutations in the genes for clotting factor VIII and IX cause hemophilia A and B, respectively. A wom...
A: Hemophilia A and B are the most common types of hemophilia, affecting men more than women. Hemophili...
Q: Compare the structures of DNA and RNA.
A: Nucleic acids are the most important organic compounds found in all living beings. The three major c...
Q: What is one of the main aspects of design for Enhanced Biological Phosphorus Removal (EBPR)? a) ...
A: EBPR is a sewage treatment method that is used to remove phosphate from sludge (activated).
Q: The process in which environmental pressures result in the differential survival and reproduction of...
A: Introduction Evolution is the key process that regulates the survivability and continuity of specie...
Q: The black color of cat fur is incompletely dominant over white and produced a hybrid grey color. Wha...
A: Incomplete dominance It is a form of intermediate inheritance in which one allele for a particular ...
Q: rforming PCR below with 1 as the
A:
Q: 170F 75C « Death in a few seconds 70°c « Death in several seconds 65°C « Death in a few minutes 140F...
A: Mesophilic bacteria are those bacteria that grow well in temperatures ranging between 20 °C to about...
Q: Domestic cats and dogs and other domesticated animals have they shown any signs of evidence of evolu...
A: Domestication is an evolved trait in which animals are selectively bred and experience significant m...
Q: Provide the embryological explanation of Humans have respiratory structures from the gut, for fishes...
A: The respiratory system is a collection of organs and tissues that assist in breathing. Your airway, ...
Q: How does methylation affect development in terms of epigenetics, cancer, and general development?
A: Answer :- Cancer cells contain adjusted DNA methylation designs. There is a lot of lessDNA methylati...
Q: A population ecologist might study the effect of an introduced predator on the _________ of particul...
A: Introduction: A predator is an animal that kills and eats other animals. Examples of predators are l...
Q: how many cells does Archaebacteria have
A: * Archaebacteria are prokaryotes thought to be bacteria. *They have a unique ribosomal RNA type. *T...
Q: Transpiration is when a plant release water vapor through its stomata which are pores its leaves and...
A: Transpiration is the course of water development through a plant and its dissipation from airborne p...
Q: QUESTION 1 Entamoeba histolytica is able to infect humans, moves using pseudopods, and is the most p...
A: Entamoeba histolytica was first discovered by Lambl in 1859 and its pathological nature was proved b...
Q: Aside from Dengue Fever what other diseases can Aedes aegypti carry? Give 3
A: Classification Kingdom : Animalia Phylum. : Arthropoda Class. : Insecta Order. : Dipter...
Q: QUESTION 2 The final step in gene expression is protein synthesis, or a. translation b. transcriptio...
A: Introduction :- The process of making protein molecules is known as protein synthesis. It includes a...
Q: How will this modified cro protein interact with the three OR sites, and how would cro expression be...
A: Bacteriophages are viruses that infect bacteria. Like other viruses bacteriophages are also made up ...
Q: Huntington’s disease is a dominant trait inheritance in humans. What is/are the possible genotype/s ...
A: Huntington 's Disease is a neurodegenerative disorder which shows autosomal dominant inheritance pat...
Q: What Data is included in a population pyramid, and what is the purpose behind the three groupings?
A: A population is defined as a group of individuals which can inter breed with each other and produce ...
Q: Molds are ubiquitous or widespread due to what visible structure? Explain in minimum of 4-5 sentence...
A: Introduction:- Molds are microscopic creatures that can be found both indoors and out. They are a na...
Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are ...
A:
Q: Define about restriction site ?
A: Recombinant DNA is made up of molecules of DNA from two different species that are inserted into a h...
Q: if two carriers of the gene for albinism marry, each of their children has probability 1/4 of being ...
A: As 1/4 are albino then 3/4 will be normal or we can say that 3/4 won't have albmino a) (3/4)6 = 0.17...
Q: The energy available to do work in a cell is called: a. thermal energy b. potential energy c. ...
A: Introduction : thermal energy - every objects has thermal energy. It's the movement of molecules w...
Q: 3. What's the difference between chronological age and biological age?
A: Introduction The length of time that someone or anything has lived or existed is referred to as thei...
Q: In cattle, a red bull (R R R R ) is crossed with a white cow (R W R W ), the heterozygous offspring ...
A:
Q: Starches with a branched structure are called O polymers O granules O amylose O amylopectin
A: Amylopectin The non-crystallizable form of starch, consisting of branched polysaccharide chains. I...
Q: What is the formula for net primary production (NPP)? How does NPP relate to energy pyramids?
A: Introduction :- The difference between the energy fixed by autotrophs and their respiration is preci...
Q: What would happen if, in the course of replication, thetopoisomerases were unable to reattach the DN...
A: DNA is a double helix molecule.
Q: Klinefelter syndrome (XXY) can most be easily diagnosed by_______ . a. pedigree analysis c. karyotyp...
A: Introduction:- Klinefelter syndrome (KS) is a hereditary disease in which a male's genetic code cont...
Q: Determines the order of the four chemical building blocks - called "bases" - that make up the DNA mo...
A: A nitrogenous base is a molecule with the chemical characteristics of a base and contains nitrogen. ...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: Mosquito repellent: the chemicals that repels the mosquito away.
Q: On the planet Rama, the DNA is of six nucleotide types: A, B, C, D, E, and F. Types A and B are call...
A: The biomolecule named nucleic acid can be divided into two categories. These categories include DNA ...
Q: Test 6- Comparing the DNA (Gene) Code for Dopamine Active Transport Protein Once dopamine triggers a...
A: Here, human DATP gene sequence of human is given , i.e : ATTCCGGATCGATATCGCCGGATATACTCCGGTAATATC
Q: 2. Draw a Punnett square of a cross between a homozygous dominant individual and a heterozygous indi...
A: Answer 1: - Parent individuals: - BB (homozygous dominant), Bb(heterozygous dominant) Cross: - ...
Q: A recognized set of symptoms that characterize a genetic disorder is a(n)______ . a. syndrome c. abn...
A: Genetic disorders are caused by genes.
Q: Tolerance in the Thymus for CD4+ and CD8+ cells is carried out where? What is meant by positive and ...
A:
Q: To understand the genetic basis of locomotion in the diploid nematode Caenorhabditis elegans, recess...
A: Introduction Genetics is a branch of biology that studies genes, genetic diversity, and heredity in ...
Q: Give the embryological explanation for "Humans have respiratory structures from the gut, for fishes,...
A: Embryological evidence is closely studying the embryological development stages of the animals.
Q: 4. During the physical examination, the nurse uses various techniques to assess structures, organs, ...
A: Auscultation - Auscultation is determined as the listening of sound of the internal organs like hear...
Q: A broth culture is initially inoculated with a single bacterial cell. For the first hour the bacteri...
A: * Given that The bacteria has generation time of 30 minutes. So it takes about thirty minutes to di...
Q: A 31-year-old woman was diagnosed with serious endogenous depression and was started on treatment wi...
A: Introduction: bioavailability is defined as the fraction (%age) of an administered drug that reaches...
Q: How are enzymes classified? What are the different classes of enzymes?
A: Enzymes are biocatalyst that is proteinaceous in nature and perform a specific type of chemical reac...
Q: 1. An albino man whose parents are both normal marries a woman one whose parents is normal and the o...
A: Introduction Albinism is an inherited condition that leads to someone having very light skin, hair, ...
Q: 4. d) mutation rate due to genetic drift
A: Answer 4. d) mutation rate due to genetic drift
Q: A glass spreader can be sterilized by dipping in 70 % ethanol and burning of excess False .a True .b
A: Introduction:- Spreaders, also known as cell spreaders, are laboratory instruments that allow sample...
Q: In roses, the synthesis of red pigment is produced by two steps in a pathway. gene O magenta interme...
A: Null mutation :- This mutation is type of loss of function mutation, in this mutation the product ma...
Q: During the Paleozoic, many life forms developed hard parts (shells/bones/etc.). Why would it be use...
A: Shelled animals, the majority of which are sea-based, come in a wide range of shapes and sizes. Beac...
Q: One of the causes of morbidity for the Zika Virus is Guillain-Barré Syndrome, an immune attack of ne...
A: Zika virus has family - flaviviridae. This virus spreds with the help of aedes mosquitoes. They nam...
![In order to view Treponema pallidum, the causative agent of syphilis, under the microscope, you can tag
the specimen with an antibody-flourescein dye complex and look under a microscope that projects UV
light onto the specimen. What test are you using?](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F7e5bc38a-9589-4f9e-aa40-8cb0e1282d2c%2F59411347-df87-4ca5-8520-254f93ca5f54%2Faogywy_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- You are working in a lab studying Streptococcus pyogenes as a cause of necrotizing fasciitiis. You have an overnight culture that you want to know the starting concentration of, so do a set of six 1:10 serial dilutions (putting 1 mL from the stock into a 9 mL blank), with tube #1 being 1:10, #2 is 1:100, etc. You plate 0.1 mL from tube 5 onto a blood agar plate and the next morning count 134 colonies. How many bacteria (measured in CFU/mL) were in the overnight culture flask? A. 1.34 x 10^4 CFU/mL B. 1.34 x 10^5 CFU/mL C. 1.34 x 10^6 CFU/mL D. 1.34 x 10^7 CFU/mL E. 1.34 x 10^8 CFU/mL F. cannot tell based on the data given - you'd need to know the volume of the original culture flaskWhat do you think the best method to detect Toxoplasma infection ?? Write the short introduction and the method??While conducting the Hydrogen Sulfide Test (SIM Agar) you open up one of the tubes and it gives off a rotten egg smell while another tube you cultured does not. What does the smell indicate? How come there was no change in color in the tube that indicated a positive test? Please explain how the color change is to occur. Think critically.
- it's so confusing, can you specify what are they positive for? like Positive for Xanthoproteic test (letters)** Negative for Xanthoproteic test. (letters)** Negative for phenol group (letters)** Has the presence of phenol group. (letters)**I AM TRYING TO IDENTIFY THIS UNKNOWN. IMAGE 1 HAS TWO PICTURE OF CATALASE TEST AND BLOOD AGAR TEST. I believe it is one of the following: 1) S. pyo. 2)S. agal . 3)S.pneu. 4)E. faecalis 5)S. aureus 6)S epi. 7)S. sapro. 8)M. luteus Please let me know which test will i need out of the table to justify your reason of picking up the unknown and also how that test justifies it? what characteristics of that test made you pick the unknown?Is the RPR Test specific for Syphilis? Why or why not?
- Is proteus vulgaris positive or negative in lia test? Why?Is the RPR Test specific for Syphilis? Why or why not? Why is a qualitative test performed before a semi-quantitative testIdentify: 1. Cell shape and arrangement in A? 2. Gram stain reaction in A? 3. Cell shape and arrangement in B? 4. Gram stain reaction in B? 5. Genus and species of B? (component of the normal flora of the skin)
- Why is it important to limit the quantity of cells used to prepare a smear? Mark all that apply: 1. So that cells are not clumped and don't entrap stain creating erroneous results 2. So that the cells are spread out enough that cell morphology can be discerned 3. So that there are small groups of cells clumped together to make them visible 4. So that no contaminants are introduced onto the slide by being entrapped in clumps 5. So that the cells are spread out enough that the arrangement can be observedIf a patient suspected to have sepsis or meningitis, samples for bacterial testing should be taken before giving antibiotics. Explain why?Name many (more than four) viruses or bacteria a titer not detect even if the patient had already been exposed? (You may need to do a little research)