In C++.......Write a program which prints the absolute value of 5 complex numbers (values read from file) and then sorts them from maximum to minimum. Read the values from a file. Use the following structure struct Complex { float x , y ; }; struct Complex read ( ) ; void Display( struct Complex a ) ; struct Complex AbsoluteValue ( struct Complex a ) ;

In C++.......Write a program which prints the absolute value of 5 complex numbers (values read from file) and then sorts them from maximum to minimum. Read the values from a file. Use the following structure struct Complex { float x , y ; }; struct Complex read ( ) ; void Display( struct Complex a ) ; struct Complex AbsoluteValue ( struct Complex a ) ;

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter8: I/o Streams And Data Files

Section: Chapter Questions

Problem 8PP: (Data processing) A bank’s customer records are to be stored in a file and read into a set of arrays...

See similar textbooks

Similar questions

(Data processing) A bank’s customer records are to be stored in a file and read into a set of arrays so that a customer’s record can be accessed randomly by account number. Create the file by entering five customer records, with each record consisting of an integer account number (starting with account number 1000), a first name (maximum of 10 characters), a last name (maximum of 15 characters), and a double-precision number for the account balance. After the file is created, write a C++ program that requests a user-input account number and displays the corresponding name and account balance from the file.
In C programming language: Write a function that takes 3 int arguments and returns the largest of the 3.
In C/C++, True or False: A function that changes the value of a variable passed by reference also changes the value of the original variable. A variable's type helps define the amount of memory it takes to hold a value of that type.
Programming Language: C++ Create a variable val with value 6. Using a pointer variable, display the value 6.
Programming Language: C++ 1. A constant cannot be passed by reference. = true or false?
pointers as Arguments:In the C programming language there is no pass-by-reference syntax to passa variable by reference to a function. Instead a variable is passed by pointer(just to be confusing, sometimes passing by pointer is referred to as pass byreference). This Practice Program asks you to do the same thing as C.Here is the header for a function that takes as input a pointer to an integer:1. void addOne (int ∗ptrNum )Complete the function so it adds one to the integer referenced by ptrNum.Write a main function where an integer variable is defined, give it an initialvalue, call addOne, and output the variable. It should be incremented by 1.
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
in c++ Write a program to generate a random number between 1 - 100, and then display which quartile the number falls in. First quartile is 1 - 25 Second quartile is 26 - 50 Third quartile is 51 - 75 Fourth quartile is 76 - 100 To generate a random number, follow these steps: include necessary header files #include <cstdlib> //for random functions #include <ctime> //for time functions set constants for the minimum and maximum values of the desired range const int MIN_VALUE = 1; //minimum range value const int MAX_VALUE = 100; //maximum range value seed the random number generator (RNG) with a unique unsigned int value - system time! unsigned seed = time(0); //system time in seconds since 1/1/1970 srand(seed); //seed the RNG get a random number in the desired range int num = (rand() % (MAX_VALUE - MIN_VALUE + 1)) + MIN_VALUE; The program should: contain header comments as shown in class display a "hello" message (more descriptive than shown in sample)…
in c++ Write a program to generate a random number between 1 - 100, and then display which quartile the number falls in. First quartile is 1 - 25Second quartile is 26 - 50Third quartile is 51 - 75Fourth quartile is 76 - 100To generate a random number, follow these steps: include necessary header files#include <cstdlib> //for random functions#include <ctime> //for time functionsset constants for the minimum and maximum values of the desired rangeconst int MIN_VALUE = 1; //minimum range valueconst int MAX_VALUE = 100; //maximum range valueseed the random number generator (RNG) with a unique unsigned int value - system time!unsigned seed = time(0); //system time in seconds since 1/1/1970srand(seed); //seed the RNGget a random number in the desired rangeint num = (rand() % (MAX_VALUE - MIN_VALUE + 1)) + MIN_VALUE;The program should: contain header comments as shown in classdisplay a "hello" message (more descriptive than shown in sample)generate a random number between 1 -…
in c language Write a program which performs the following actions: Write the header of the C program Write the beginning of the main function Initialize a string called first_string with the constant value "C programming is nice**" using a string pointers Initialize a string called second_string with the constant value "C language is difficult" using a string pointer Display first_string and second_string in two consecutive lines Display a message that shows if the two strings have the same length (hint: use sizeof). Assume now that both strings have the same size. Write only three statements to swap the two strings’ contents (swap means the content of the first string becomes the content of the second string and vice-versa) Display again the two strings to check whether they have been swapped Write the correct symbol to close the main function
A header of a C-language function is: void recurs(int current_level, int max_level ) The keyword "void" here signifies
Home Work 2: It is required from you to write a code in C language to find the average for any five numbers.