In 1894used a corpse and figured out that awasresponsible for the symptoms of the plague.Louis Pasteur, bacteriumRobert Koch, protistAlexander Yersin, protistAlexander Yersin, bacterium

Louis Pasture gave rabies vaccine, anthrax vaccine, cholera vaccine and also gave the pasteurisation…

Answered: In 1894 used a corpse and figured out…

In 1894 used a corpse and figured out that a was responsible for the symptoms of the plague. O Louis Pasteur, bacterium O Robert Koch, protist O Alexander Yersin, protist Alexander Yersin, bacterium

Aquaculture Science

3rd Edition

ISBN:9781133558347

Author:Parker

Publisher:Parker

Chapter11: Health Of Aquatic Animals

Section: Chapter Questions

Problem 5KA

See similar textbooks

Related questions

Q: Which scientist first disproved spontaneous generation byshowing that maggots only appear on…

A: Spontaneous generation can be defined as the process in which there is the maturation of the living…

Q: Which structure protects bacteria from being phagocytized? O fimbriae cell membrane O capsule slime…

A: Introduction :- Phagocytosis is the process through which phagocytes, or living cells, consume or…

Q: Which group of eubacteria causes the STI syphilis? 1. proteobacteria 2. green bacteria…

A: Bacteria are the prokaryotes which don't contain well defined nucleus.

Q: What does biofilms look like add images Biofilms

A: Biofilms are the film or the thin layer that is responsible for the contamination of the medical…

Q: Early principles of infection control are attributed to? O a. Louis Pasteur b. Edward Jenner O C.…

A: Louis Pasteur was a father of immunology as he introduced a clear concept of vaccination after…

Q: Which one of these is not considered a microbe or microorganism? Viruses Bacteria Ticks Dragongfly…

A: Introduction:- A microorganism, sometimes known as a microbe, is a microscopic organism that can…

Q: Which of the following microbes produces a natural biopesticide?a. Penicillium chrysogenum b.…

A: Biological pesticides are otherwise known as biopesticides and refer to the unique type of pest…

Q: An apple pie has 3 million bacterial cells. The crust might have been inoculated with 500 bacterium.…

A: Bacteria are prokaryotic organisms. They reproduce asexually without the formation of gametes.…

Q: Which of the following is the most resistant to destruction bychemicals and heat?a) Bacterial…

A: The given microorganisms are some of the known agents that can cause disease and can contaminate a…

Q: Which of the following is not considered a microorganism?a. algab. bacteriumc. protozoand. mushroom

A: The organisms that cannot be observed with unaided eyes are the microorganisms. The microbes could…

Q: Abiogenesisa. refers to the spontaneous generation of organisms from nonliving matter. b. explains…

A: The existence of the planet earth dates back to many billion years ago. However, there was no life…

Q: why it could be damaging to expose your own normal flora/microbiome to antibiotics.

A: The microbiome consists of all the microorganisms that are normally present in the body.

Q: Which of the following is false/mismatched? a. Pasteur: disproves spontaneous generation of microbes…

A: The given sentences belong to the History of development in the field of Medicine and prevention.…

Q: Which of the following bacteria contain "Endotoxin" as an important constituent of its structure?…

A: NOTE-"As per our honor code, we are authorized to answer only one question at a moment. As you have…

Q: Archaea are generally resistant to penicillin since they lack a peptidoglycan layer. Select one:…

A: These are single celled organisms which are somewhat similar to bacteria and somewhat like…

Q: If you read that coliforms had been found in a lake, the report could have been referring to which…

A: Coliforms cover a broad group of microorganisms that are present in the environment. They are…

Q: Which is the correct way to denote the scientifi c name of a microorganism? a. e. coli.b. E. coli…

A: Step 1 Nomenclature is providing proper, specific, and distinguishing names to each and every…

Q: Which of these microbes has the most complex cell wall? fungi bacteria protozoa…

A: Cell wall:- A cell wall is a structural layer surrounding some types of cells, just outside the cell…

Q: Which of the following is an acellular microorganism lacking a nucleus?a. bacterium b. helminth.…

A: Bacterium,helminth and protozoa fall under the category of cellular organisms.i.e. presence of cell…

Q: Which of the following is not considered a microorganism?a. alga b. bacterium c. protozoan d. flea

A: A microorganism or Microscopic organisms are single-celled. Here we have to check which of the…

Q: A veterinarian suspects that a new disease of house cats is caused by a specific type of bacterium.…

A: The germ theory of disease was given by a German scientist named Robert Koch. He, in his theory,…

Q: eria and Oxygen 1 Obligate anaerobes Cannot live in the presence of Ex. Archaebacteria o Lives in…

A: Aerobes are the organisms that live in the presence of Oxygen and anaerobes are the organism that…

Q: Prokaryotes are all around us. What experiment can be Developed to visualize these microbes from an…

A: Prokaryotic cells are single-celled having unicellular organisms.

Q: Which early microbiologist was most responsible for developingstandard microbiology laboratory…

A: Standard microbiology techniques include- 1. Inoculating plates 2. Inoculating broth 3. Using…

Q: Describe the experiments Pasteur used to disprove theidea of spontaneous generation

A: Spontaneous generation is defined as an ordinary formation of living organisms from nonliving…

Q: 1. Yeast is a type of fungus. 2. Probiotics are good bacteria. _3. All microorganisms are causing…

A: The microscopic organism that is unicellular or multicellular is called microorganisms. They are…

Q: Methanogens are a group of organisms that belong to the: O a. Kingdom Bacteria O b. Domain Archaea O…

A: The classification levels become more specific towards the bottom of the hierarchy. Many organisms…

Q: Which scientist is most responsible for finally laying the theory ofspontaneous generation to…

A: The theory of spontaneous generation suggests that life arose from non-living matter. It was given…

Q: Which organism is least likely to cause disease? bacteria protozoa algae parasitic worms viruses

Q: Bacteriology: The study of bacteria and - parasites True False

A: Bacteria represent a wide range of prokaryotic microorganisms. Bacteria usually have several…

Q: Bacteria Viruses Protozoa Fungi The name of the organism and category it belongs to The biological…

A: Answer :: Bacteria: Name and category: Lactobacillus acidophilus. Probiotic bacteria. Biological…

Q: a. Bacteria – Escherichia coli; Neisseria catarralis; Vibrio coma b. Algae – nostoc, anabaena,…

A: BACTERIA Escherichia coli:- E. coli are harmless and actually are an important part of a healthy…

Q: Antibiotics any group of chemical substance duced by various microorganisms and fungi the growth or…

A: Antibiotics are antimicrobial agents that are responsible for treating infections produced by…

Q: Most of the bacteria are harmful. O True O False All prokaryotes are placed in one of the six…

A: Bacteria are the ubiquitous single-celled microbes that fall under the kingdom Monera. Bacteria are…

Q: Word bank: bacteria, archaea, algae, fungi, protozoa, invertebrates Blank 1________ never cause…

A: Bacteria , algae , fungi , protozoa can cuase diseases in humans. Many invertebrates are also…

Q: Bacteriophages are O a. cellular components. O b. protistans. O C. viruses. d. prions. O e.…

A: Bacteriophages These are infectious agents, and are also known as phages. These are composed of…

Q: Which genus of bacteria has pathogens that can cause blindness?a. Streptococcus b. Staphylococcus c.…

A: Bacteria are the most important microorganisms to the food processor. Some bacteria are beneficial…

Q: 14. Bioremediation is a frocess used to treat contaminated media, including water or soil by…

A: Bioremediation refers to the phenomenon in which contaminated media is treated. It also includes…

Q: Describe what happens in an E. coli bacterium that has been living on the top of your fridge for the…

A: A vast majority of eubacteria and archaea bacteria grow in diverse environmental conditions include…

Q: Koch's Postulate proved that: normal flora are necessary for life some diseases are…

A: Answer of the question given below.

Q: art III VARNING! IMPORTANT SAFETY RULES ways wash your hands well with soap and water after h- gs…

A: An egg is composed of white and yolk. The yolk can be yellow or orange color. The color of the yolk…

Q: What was Robert Koch's contribution to microbiology? He has proven the involvement of bacteria in…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: The Chine's letter arrangement of cell is a distinguishing feature for Listera sp. Clostridium sp.…

A: Introduction:- Chinese letter arrangements of cells is seen with corynebacterium species . It is…

Q: Give a reason why there’s a higher abundance of bacteria swabbed from the front of the compared ti…

A: Bacteria are prokaryotic organisms found everywhere.

Q: Streak plate allows microbiologists to isolate one species of bacteria from another. Why is that…

A: Aseptic technique is basically the mindset of keeping things free of contamination, as the world we…

Q: Which group of bacteria are missing a nucleus? 1. proteobacteria 2. green bacteria 3.…

Concept explainers

Pre-Darwinian Concepts

Question

100%

In 1894
used a corpse and figured out that a
was
responsible for the symptoms of the plague.
Louis Pasteur, bacterium
Robert Koch, protist
Alexander Yersin, protist
Alexander Yersin, bacterium

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In which Phylum is this organism classified? visuals:unlimfted
The image below is an example of O Bacteria O Fungi O Virus O Helminths
Shigella sonnei - a short paragraph on the clinical significance of the organism.
List the main features of Koch’s postulates and explain why it is sodifficult to prove them for some diseases.
Which group of eubacteria causes the STI syphilis? 1. proteobacteria 2. green bacteria 3.cyanobacteria 4. gram positive bacteria 5. spirochetes 6. chlamydia
You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Match pathogen to common site of hospital-acquired infection. Make matches so you use each letter one time. 33. forms endospores, causes serious diarrhea Resistant Staphylococcus Aureus A. Methicillin- 34. gram-negative opportunist, burn infections, pneumonia difficile 35. typical large intestine flora, causes urinary tract infections 36. broadly antibiotic-resistant, causes infections anywhere in body aeruginosa B. Clostridium C. Escherichia coli D. Pseudomonas 37. If a disease can use in a room where air does not freely flow out of the room. transmission, a patient with that disease will need to be A. droplet B. contact C. airborne D. fecal-oral 38. Handwashing will not prevent transmission of a pathogen. A. direct contact B. fomite C. vector D. fecal-oral 39- A 27-year old unmarried female patient presents with genital warts. A-Which one of the following viruses is the most likely cause? 1- Herpes simplex virus 2- Epstein-Barr virus 3- Hanta virus 4-HPV S-HIV B- Which one of the…
If you have two yeast strains, (One pathenic and one not) how could you tell which one causes illness using Kochs Postulates/
Please someone help me, please chose other than T.Brucei and Diatoms thabk you
Which ones apply to the picture? Vibro, Tetrad, Staphylo, Strepto, Coccus, Spirillum, Spirochetes, Bacillus, Spiral, Sarcina
QUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
Name the bacterias and good benefits to humans. Good Bacteria Benefits 1. 2 3 4 5 6 7 8 9 10